EMAIL THIS PAGE TO A FRIEND

MALL

mal, T-cell differentiation protein-like

64 Gene Product Result for
Synonyms: BENE
UniProtKB ID: Q13021, B3KWR6, Q9BTU0
Gene ID:
Human(7851) Summary: This gene encodes an element of the machinery for raft-mediated trafficking in endothelial cells. The encoded protein, a member of the MAL proteolipid family, predominantly localizes in glycolipid- and cholesterol-enriched membrane (GEM) rafts. It interacts with caveolin-1. [provided by RefSeq, Jul 2008]
Mouse(228576) mal, T cell differentiation protein-like
Rat(362211) mal, T-cell differentiation protein-like
chicken(421222) mal, T-cell differentiation protein-like
dog(483056) mal, T-cell differentiation protein-like
domestic cat(101085541) mal, T-cell differentiation protein-like
cow(512289) mal, T-cell differentiation protein-like
sheep(101116299) mal, T-cell differentiation protein-like
naked mole-rat(101726482) mal, T-cell differentiation protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086441 MISSION® esiRNA esiRNA targeting mouse Mall (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005434 Rosetta Predictions human pricing
NM_001014182 Rosetta Predictions rat pricing
NM_145532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174027 predicted 495
2 SASI_Hs01_00174028 predicted 435
3 SASI_Hs01_00174029 predicted 642
4 SASI_Hs01_00174030 predicted 536
5 SASI_Hs01_00174031 predicted 882
6 SASI_Hs01_00174034 predicted 810
7 SASI_Hs02_00339585 predicted 899
8 SASI_Hs01_00174035 predicted 628
9 SASI_Hs02_00339586 predicted 584
10 SASI_Hs02_00339587 predicted 606
11 SASI_Hs01_00174026 predicted 615
12 SASI_Hs01_00174032 predicted 497
13 SASI_Hs01_00174033 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045710 predicted 540
2 SASI_Rn01_00045711 predicted 611
3 SASI_Rn01_00045712 predicted 947
4 SASI_Rn01_00045713 predicted 854
5 SASI_Rn02_00201687 predicted 399
6 SASI_Rn01_00045714 predicted 550
7 SASI_Rn01_00045715 predicted 207
8 SASI_Rn01_00045717 predicted 523
9 SASI_Rn01_00045718 predicted 459
10 SASI_Rn01_00045719 predicted 464
11 SASI_Rn01_00045716 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039822 predicted 525
2 SASI_Mm01_00039823 predicted 256
3 SASI_Mm01_00039824 predicted 469
4 SASI_Mm01_00039825 predicted 540
5 SASI_Mm02_00341013 predicted 655
6 SASI_Mm01_00039826 predicted 370
7 SASI_Mm01_00039827 predicted 438
8 SASI_Mm01_00039828 predicted 530
9 SASI_Mm02_00341014 predicted 485
10 SASI_Mm01_00039830 predicted 485
11 SASI_Mm01_00039821 predicted 410
12 SASI_Mm01_00039829 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005434
MALL MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-604s1c1
Sequence:CCGGCTACAAGTACATGCCACGATTCTCGAGAATCGTGGCATGTACTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-474s1c1
Sequence:CCGGCTCGTTTCTCATCTCCTTGATCTCGAGATCAAGGAGATGAGAAACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005434.3-899s1c1
Sequence:CCGGCCACACTTTGTTTGGACATTTCTCGAGAAATGTCCAAACAAAGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-378s1c1
Sequence:CCGGCGAGCTGATATTTGGGTTCTTCTCGAGAAGAACCCAAATATCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-1131s21c1
Sequence:CCGGACTGCTGGACCCAAGAATTTACTCGAGTAAATTCTTGGGTCCAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-992s21c1
Sequence:CCGGTCCTGTTGTCTTACTTGTTTGCTCGAGCAAACAAGTAAGACAACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005434
MALL MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-604s1c1
Sequence:CCGGCTACAAGTACATGCCACGATTCTCGAGAATCGTGGCATGTACTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-474s1c1
Sequence:CCGGCTCGTTTCTCATCTCCTTGATCTCGAGATCAAGGAGATGAGAAACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005434.3-899s1c1
Sequence:CCGGCCACACTTTGTTTGGACATTTCTCGAGAAATGTCCAAACAAAGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-378s1c1
Sequence:CCGGCGAGCTGATATTTGGGTTCTTCTCGAGAAGAACCCAAATATCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-1131s21c1
Sequence:CCGGACTGCTGGACCCAAGAATTTACTCGAGTAAATTCTTGGGTCCAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-992s21c1
Sequence:CCGGTCCTGTTGTCTTACTTGTTTGCTCGAGCAAACAAGTAAGACAACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005434
MALL MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-604s1c1
Sequence:CCGGCTACAAGTACATGCCACGATTCTCGAGAATCGTGGCATGTACTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-474s1c1
Sequence:CCGGCTCGTTTCTCATCTCCTTGATCTCGAGATCAAGGAGATGAGAAACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005434.3-899s1c1
Sequence:CCGGCCACACTTTGTTTGGACATTTCTCGAGAAATGTCCAAACAAAGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005434.3-378s1c1
Sequence:CCGGCGAGCTGATATTTGGGTTCTTCTCGAGAAGAACCCAAATATCAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-1131s21c1
Sequence:CCGGACTGCTGGACCCAAGAATTTACTCGAGTAAATTCTTGGGTCCAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005434.4-992s21c1
Sequence:CCGGTCCTGTTGTCTTACTTGTTTGCTCGAGCAAACAAGTAAGACAACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145532
MALL MISSION shRNA Bacterial Glycerol Stock
mal, T-cell differentiation protein-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145532.2-1667s1c1
Sequence:CCGGCGACAGTCCAACCATCTAAATCTCGAGATTTAGATGGTTGGACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-470s1c1
Sequence:CCGGGCACGCTTTCAGCATCTATTACTCGAGTAATAGATGCTGAAAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-469s1c1
Sequence:CCGGTGCACGCTTTCAGCATCTATTCTCGAGAATAGATGCTGAAAGCGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-405s1c1
Sequence:CCGGAGCCACTACTACATCAATGTTCTCGAGAACATTGATGTAGTAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-458s1c1
Sequence:CCGGGCTCTATATCCTGCACGCTTTCTCGAGAAAGCGTGCAGGATATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-534s21c1
Sequence:CCGGCCGCGTGATTATCCCTCAAAGCTCGAGCTTTGAGGGATAATCACGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-894s21c1
Sequence:CCGGGGTGCTCTGTCTGATACATTTCTCGAGAAATGTATCAGACAGAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145532
MALL MISSION shRNA shRNA Plasmid DNA
mal, T-cell differentiation protein-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145532.2-1667s1c1
Sequence:CCGGCGACAGTCCAACCATCTAAATCTCGAGATTTAGATGGTTGGACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-470s1c1
Sequence:CCGGGCACGCTTTCAGCATCTATTACTCGAGTAATAGATGCTGAAAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-469s1c1
Sequence:CCGGTGCACGCTTTCAGCATCTATTCTCGAGAATAGATGCTGAAAGCGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-405s1c1
Sequence:CCGGAGCCACTACTACATCAATGTTCTCGAGAACATTGATGTAGTAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-458s1c1
Sequence:CCGGGCTCTATATCCTGCACGCTTTCTCGAGAAAGCGTGCAGGATATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-534s21c1
Sequence:CCGGCCGCGTGATTATCCCTCAAAGCTCGAGCTTTGAGGGATAATCACGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-894s21c1
Sequence:CCGGGGTGCTCTGTCTGATACATTTCTCGAGAAATGTATCAGACAGAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145532
MALL MISSION shRNA Lentiviral Transduction Particles
mal, T-cell differentiation protein-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145532.2-1667s1c1
Sequence:CCGGCGACAGTCCAACCATCTAAATCTCGAGATTTAGATGGTTGGACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-470s1c1
Sequence:CCGGGCACGCTTTCAGCATCTATTACTCGAGTAATAGATGCTGAAAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-469s1c1
Sequence:CCGGTGCACGCTTTCAGCATCTATTCTCGAGAATAGATGCTGAAAGCGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-405s1c1
Sequence:CCGGAGCCACTACTACATCAATGTTCTCGAGAACATTGATGTAGTAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145532.2-458s1c1
Sequence:CCGGGCTCTATATCCTGCACGCTTTCTCGAGAAAGCGTGCAGGATATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-534s21c1
Sequence:CCGGCCGCGTGATTATCCCTCAAAGCTCGAGCTTTGAGGGATAATCACGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145532.3-894s21c1
Sequence:CCGGGGTGCTCTGTCTGATACATTTCTCGAGAAATGTATCAGACAGAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)