EMAIL THIS PAGE TO A FRIEND

MALSU1

mitochondrial assembly of ribosomal large subunit 1

41 Gene Product Result for
Synonyms: C7orf30 mtRsfA
UniProtKB ID: Q96EH3, A4D154
Gene ID:
Mouse(75593) mitochondrial assembly of ribosomal large subunit 1
Rat(297082) mitochondrial assembly of ribosomal large subunit 1
domestic guinea pig(100719596) mitochondrial assembly of ribosomal large subunit 1
naked mole-rat(101725344) mitochondrial assembly of ribosomal large subunit 1
sheep(101110227) mitochondrial assembly of ribosomal large subunit 1
dog(611116) mitochondrial assembly of ribosomal large subunit 1
domestic cat(101095729) mitochondrial assembly of ribosomal large subunit 1
cow(509253) mitochondrial assembly of ribosomal large subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138446 Rosetta Predictions human pricing
NM_001106593 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363611 predicted 259
2 SASI_Hs01_00171474 predicted 280
3 SASI_Hs02_00363612 predicted 397
4 SASI_Hs01_00171475 predicted 491
5 SASI_Hs02_00363613 predicted 374
6 SASI_Hs01_00171476 predicted 404
7 SASI_Hs01_00171477 predicted 296
8 SASI_Hs01_00171478 predicted 294
9 SASI_Hs01_00171480 predicted 254
10 SASI_Hs01_00171481 predicted 384
11 SASI_Hs01_00171473 predicted 380
12 SASI_Hs01_00171479 predicted 347
13 SASI_Hs01_00171482 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220478 predicted 327
2 SASI_Rn02_00220479 predicted 286
3 SASI_Rn02_00220480 predicted 454
4 SASI_Rn02_00220481 predicted 460
5 SASI_Rn02_00220482 predicted 414
6 SASI_Rn02_00220483 predicted 325
7 SASI_Rn02_00220484 predicted 430
8 SASI_Rn02_00220485 predicted 273
9 SASI_Rn02_00220486 predicted 504
10 SASI_Rn02_00220487 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138446
VALIDATED
MALSU1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial assembly of ribosomal large subunit 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-683s21c1
Sequence:CCGGTGGAATAGAAGATGATACTTCCTCGAGGAAGTATCATCTTCTATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-395s21c1
Sequence:CCGGAGATTACTTTGTGATTGTTAGCTCGAGCTAACAATCACAAAGTAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-707s21c1
Sequence:CCGGTGTGACTCCAGTGGAGTTAAACTCGAGTTTAACTCCACTGGAGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-661s21c1
Sequence:CCGGCAGTACCTGAAGACTTCATTCCTCGAGGAATGAAGTCTTCAGGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138446.1-365s1c1
Sequence:CCGGGATCCAGGTTCCTCCAGAAATCTCGAGATTTCTGGAGGAACCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-572s1c1
Sequence:CCGGGCTTCCAGAAACCAGAGAAATCTCGAGATTTCTCTGGTTTCTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-489s1c1
Sequence:CCGGCGTGACCCTCATGTTAAGATACTCGAGTATCTTAACATGAGGGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-354s1c1
Sequence:CCGGGACATTTGTGTGATCCAGGTTCTCGAGAACCTGGATCACACAAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138446
VALIDATED
MALSU1 MISSION shRNA shRNA Plasmid DNA
mitochondrial assembly of ribosomal large subunit 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-683s21c1
Sequence:CCGGTGGAATAGAAGATGATACTTCCTCGAGGAAGTATCATCTTCTATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-395s21c1
Sequence:CCGGAGATTACTTTGTGATTGTTAGCTCGAGCTAACAATCACAAAGTAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-707s21c1
Sequence:CCGGTGTGACTCCAGTGGAGTTAAACTCGAGTTTAACTCCACTGGAGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-661s21c1
Sequence:CCGGCAGTACCTGAAGACTTCATTCCTCGAGGAATGAAGTCTTCAGGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138446.1-365s1c1
Sequence:CCGGGATCCAGGTTCCTCCAGAAATCTCGAGATTTCTGGAGGAACCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-572s1c1
Sequence:CCGGGCTTCCAGAAACCAGAGAAATCTCGAGATTTCTCTGGTTTCTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-489s1c1
Sequence:CCGGCGTGACCCTCATGTTAAGATACTCGAGTATCTTAACATGAGGGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-354s1c1
Sequence:CCGGGACATTTGTGTGATCCAGGTTCTCGAGAACCTGGATCACACAAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138446
VALIDATED
MALSU1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial assembly of ribosomal large subunit 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-683s21c1
Sequence:CCGGTGGAATAGAAGATGATACTTCCTCGAGGAAGTATCATCTTCTATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-395s21c1
Sequence:CCGGAGATTACTTTGTGATTGTTAGCTCGAGCTAACAATCACAAAGTAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-707s21c1
Sequence:CCGGTGTGACTCCAGTGGAGTTAAACTCGAGTTTAACTCCACTGGAGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138446.1-661s21c1
Sequence:CCGGCAGTACCTGAAGACTTCATTCCTCGAGGAATGAAGTCTTCAGGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138446.1-365s1c1
Sequence:CCGGGATCCAGGTTCCTCCAGAAATCTCGAGATTTCTGGAGGAACCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-572s1c1
Sequence:CCGGGCTTCCAGAAACCAGAGAAATCTCGAGATTTCTCTGGTTTCTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-489s1c1
Sequence:CCGGCGTGACCCTCATGTTAAGATACTCGAGTATCTTAACATGAGGGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138446.1-354s1c1
Sequence:CCGGGACATTTGTGTGATCCAGGTTCTCGAGAACCTGGATCACACAAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)