EMAIL THIS PAGE TO A FRIEND

MAMDC2

MAM domain containing 2

220 Gene Product Result for
UniProtKB ID: Q7Z304, Q5VW47, Q8WX43, Q96BM4
Gene ID:
Mouse(71738) MAM domain containing 2
Rat(309410) MAM domain containing 2
chicken(427247) MAM domain containing 2
dog(608871) MAM domain containing 2
Horse(100056213) MAM domain containing 2
domestic cat(101086185) MAM domain containing 2
domestic guinea pig(100724943) MAM domain containing 2
naked mole-rat(101719881) MAM domain containing 2
Domestic Rabbit(100341487) MAM domain containing 2
sheep(101105215) MAM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019401 MISSION® esiRNA esiRNA targeting human MAMDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153267 Rosetta Predictions human pricing
XM_001078660 Rosetta Predictions rat pricing
XM_219905 Rosetta Predictions rat pricing
NM_174857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367146 predicted 1564
2 SASI_Hs01_00217363 predicted 2262
3 SASI_Hs01_00217364 predicted 819
4 SASI_Hs01_00217365 predicted 1088
5 SASI_Hs01_00217366 predicted 1171
6 SASI_Hs01_00217368 predicted 2242
7 SASI_Hs01_00217369 predicted 2528
8 SASI_Hs01_00217370 predicted 737
9 SASI_Hs02_00367147 predicted 2521
10 SASI_Hs01_00217371 predicted 1024
11 SASI_Hs01_00217362 predicted 2133
12 SASI_Hs01_00217367 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361607 predicted 2111
2 SASI_Rn02_00361608 predicted 640
3 SASI_Rn02_00361609 predicted 2018
4 SASI_Rn02_00361610 predicted 2007
5 SASI_Rn02_00361611 predicted 2060
6 SASI_Rn02_00361612 predicted 416
7 SASI_Rn02_00361613 predicted 227
8 SASI_Rn02_00361614 predicted 2139
9 SASI_Rn02_00361615 predicted 303
10 SASI_Rn02_00361616 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378845 predicted 318
2 SASI_Rn02_00378846 predicted 2009
3 SASI_Rn02_00378847 predicted 1998
4 SASI_Rn02_00378848 predicted 2048
5 SASI_Rn02_00378849 predicted 216
6 SASI_Rn02_00378850 predicted 629
7 SASI_Rn02_00378851 predicted 2127
8 SASI_Rn02_00378852 predicted 1941
9 SASI_Rn02_00378853 predicted 466
10 SASI_Rn02_00378854 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148989 predicted 1275
2 SASI_Mm01_00148990 predicted 1485
3 SASI_Mm01_00148991 predicted 2269
4 SASI_Mm01_00148992 predicted 1855
5 SASI_Mm01_00148993 predicted 2213
6 SASI_Mm01_00148994 predicted 1996
7 SASI_Mm01_00148995 predicted 1030
8 SASI_Mm01_00148996 predicted 1293
9 SASI_Mm01_00148997 predicted 759
10 SASI_Mm01_00148998 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153267
MAMDC2 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-2542s21c1
Sequence:CCGGCCATTCGAGGAGTATCAATAACTCGAGTTATTGATACTCCTCGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-1742s21c1
Sequence:CCGGCACTACAGGCTTAGGGTATTACTCGAGTAATACCCTAAGCCTGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-859s21c1
Sequence:CCGGTCCGTTTGGTCTACCAGATAACTCGAGTTATCTGGTAGACCAAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153267.3-3122s1c1
Sequence:CCGGGCTAATGAGTTAGTCTGGAAACTCGAGTTTCCAGACTAACTCATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1150s1c1
Sequence:CCGGCCCAATGTGAACTGGTTTGTTCTCGAGAACAAACCAGTTCACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-743s1c1
Sequence:CCGGGCCATTACATTTATGTGGATACTCGAGTATCCACATAAATGTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1959s1c1
Sequence:CCGGGCAAGCTGAAATCACCTTTAACTCGAGTTAAAGGTGATTTCAGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-2047s1c1
Sequence:CCGGGCCCTGGATGACATTACAATACTCGAGTATTGTAATGTCATCCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153267
MAMDC2 MISSION shRNA shRNA Plasmid DNA
MAM domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-2542s21c1
Sequence:CCGGCCATTCGAGGAGTATCAATAACTCGAGTTATTGATACTCCTCGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-1742s21c1
Sequence:CCGGCACTACAGGCTTAGGGTATTACTCGAGTAATACCCTAAGCCTGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-859s21c1
Sequence:CCGGTCCGTTTGGTCTACCAGATAACTCGAGTTATCTGGTAGACCAAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153267.3-3122s1c1
Sequence:CCGGGCTAATGAGTTAGTCTGGAAACTCGAGTTTCCAGACTAACTCATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1150s1c1
Sequence:CCGGCCCAATGTGAACTGGTTTGTTCTCGAGAACAAACCAGTTCACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-743s1c1
Sequence:CCGGGCCATTACATTTATGTGGATACTCGAGTATCCACATAAATGTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1959s1c1
Sequence:CCGGGCAAGCTGAAATCACCTTTAACTCGAGTTAAAGGTGATTTCAGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-2047s1c1
Sequence:CCGGGCCCTGGATGACATTACAATACTCGAGTATTGTAATGTCATCCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153267
MAMDC2 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-2542s21c1
Sequence:CCGGCCATTCGAGGAGTATCAATAACTCGAGTTATTGATACTCCTCGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-1742s21c1
Sequence:CCGGCACTACAGGCTTAGGGTATTACTCGAGTAATACCCTAAGCCTGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153267.4-859s21c1
Sequence:CCGGTCCGTTTGGTCTACCAGATAACTCGAGTTATCTGGTAGACCAAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153267.3-3122s1c1
Sequence:CCGGGCTAATGAGTTAGTCTGGAAACTCGAGTTTCCAGACTAACTCATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1150s1c1
Sequence:CCGGCCCAATGTGAACTGGTTTGTTCTCGAGAACAAACCAGTTCACATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-743s1c1
Sequence:CCGGGCCATTACATTTATGTGGATACTCGAGTATCCACATAAATGTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-1959s1c1
Sequence:CCGGGCAAGCTGAAATCACCTTTAACTCGAGTTAAAGGTGATTTCAGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153267.3-2047s1c1
Sequence:CCGGGCCCTGGATGACATTACAATACTCGAGTATTGTAATGTCATCCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174857
MAMDC2 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174857.1-2857s1c1
Sequence:CCGGGCGCTAATTCATGCTGCCTTACTCGAGTAAGGCAGCATGAATTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1550s1c1
Sequence:CCGGGCCGTTTATATCTTTGAAGAACTCGAGTTCTTCAAAGATATAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1501s1c1
Sequence:CCGGGCGCTTTCATTACGCCATCTTCTCGAGAAGATGGCGTAATGAAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1630s1c1
Sequence:CCGGGCAAGCGGAAATCAGTTTCAACTCGAGTTGAAACTGATTTCCGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-392s1c1
Sequence:CCGGCCTTGGATACTAAATGAGGAACTCGAGTTCCTCATTTAGTATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174857
MAMDC2 MISSION shRNA shRNA Plasmid DNA
MAM domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174857.1-2857s1c1
Sequence:CCGGGCGCTAATTCATGCTGCCTTACTCGAGTAAGGCAGCATGAATTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1550s1c1
Sequence:CCGGGCCGTTTATATCTTTGAAGAACTCGAGTTCTTCAAAGATATAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1501s1c1
Sequence:CCGGGCGCTTTCATTACGCCATCTTCTCGAGAAGATGGCGTAATGAAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1630s1c1
Sequence:CCGGGCAAGCGGAAATCAGTTTCAACTCGAGTTGAAACTGATTTCCGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-392s1c1
Sequence:CCGGCCTTGGATACTAAATGAGGAACTCGAGTTCCTCATTTAGTATCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174857
MAMDC2 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174857.1-2857s1c1
Sequence:CCGGGCGCTAATTCATGCTGCCTTACTCGAGTAAGGCAGCATGAATTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1550s1c1
Sequence:CCGGGCCGTTTATATCTTTGAAGAACTCGAGTTCTTCAAAGATATAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1501s1c1
Sequence:CCGGGCGCTTTCATTACGCCATCTTCTCGAGAAGATGGCGTAATGAAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-1630s1c1
Sequence:CCGGGCAAGCGGAAATCAGTTTCAACTCGAGTTGAAACTGATTTCCGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174857.1-392s1c1
Sequence:CCGGCCTTGGATACTAAATGAGGAACTCGAGTTCCTCATTTAGTATCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)