EMAIL THIS PAGE TO A FRIEND

MAMDC4

MAM domain containing 4

53 Gene Product Result for
Synonyms: AEGP
UniProtKB ID: Q6UXC1, A2A3D4, B0QZ81, Q5T5S2, Q8NCX7
Gene ID:
Mouse(381352) MAM domain containing 4
Rat(252882) MAM domain containing 4
chicken(427780) MAM domain containing 4
chicken(101665301) MAM domain containing 4
chicken(101751695) MAM domain containing 4
dog(491244) MAM domain containing 4
domestic cat(101098589) MAM domain containing 4
Horse(100068052) MAM domain containing 4
cow(515379) MAM domain containing 4
naked mole-rat(101706126) MAM domain containing 4
domestic guinea pig(100718782) MAM domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059977 Anti-MAMDC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039421 MISSION® esiRNA esiRNA human MAMDC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206920 Rosetta Predictions human pricing
NM_145768 Rosetta Predictions rat pricing
NM_001081199 Rosetta Predictions mouse pricing
XM_355317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202077 predicted 674
2 SASI_Hs01_00202078 predicted 293
3 SASI_Hs02_00373611 predicted 1723
4 SASI_Hs01_00202079 predicted 848
5 SASI_Hs01_00202080 predicted 1770
6 SASI_Hs01_00202081 predicted 3130
7 SASI_Hs01_00202082 predicted 830
8 SASI_Hs01_00202084 predicted 275
9 SASI_Hs01_00202085 predicted 2666
10 SASI_Hs01_00202086 predicted 682
11 SASI_Hs01_00202083 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108186 predicted 3635
2 SASI_Rn01_00108187 predicted 1308
3 SASI_Rn02_00268754 predicted 1353
4 SASI_Rn01_00108188 predicted 1744
5 SASI_Rn01_00108189 predicted 1320
6 SASI_Rn01_00108190 predicted 2489
7 SASI_Rn01_00108191 predicted 3676
8 SASI_Rn01_00108192 predicted 1393
9 SASI_Rn01_00108193 predicted 974
10 SASI_Rn01_00108194 predicted 3661
11 SASI_Rn01_00108195 predicted 3252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296161 predicted 1279
2 SASI_Mm02_00296162 predicted 611
3 SASI_Mm02_00296163 predicted 2467
4 SASI_Mm02_00296164 predicted 1359
5 SASI_Mm02_00296165 predicted 682
6 SASI_Mm02_00296166 predicted 1407
7 SASI_Mm02_00296167 predicted 408
8 SASI_Mm02_00296168 predicted 3729
9 SASI_Mm02_00296169 predicted 886
10 SASI_Mm02_00296170 predicted 3722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255733 predicted 2985
2 SASI_Mm01_00255734 predicted 2089
3 SASI_Mm01_00255735 predicted 3403
4 SASI_Mm01_00255736 predicted 2475
5 SASI_Mm01_00255737 predicted 1359
6 SASI_Mm01_00255738 predicted 3738
7 SASI_Mm01_00255739 predicted 882
8 SASI_Mm01_00255740 predicted 2466
9 SASI_Mm01_00255741 predicted 2189
10 SASI_Mm01_00255742 predicted 2126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206920
MAMDC4 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1077s1c1
Sequence:CCGGGTCTTCTATCAGTACCTGAGTCTCGAGACTCAGGTACTGATAGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-3126s1c1
Sequence:CCGGGAGTTCCAGATCGTGTTTGAACTCGAGTTCAAACACGATCTGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1731s1c1
Sequence:CCGGGAACTCCACCTGGCTTATTATCTCGAGATAATAAGCCAGGTGGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-1781s21c1
Sequence:CCGGTAACTTTGAGCGGGACACATGCTCGAGCATGTGTCCCGCTCAAAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-821s21c1
Sequence:CCGGGTCTGATGAGAACCCACTCACCTCGAGGTGAGTGGGTTCTCATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206920.2-3490s21c1
Sequence:CCGGCTCACGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-2972s1c1
Sequence:CCGGCTTCTGGTACCACATGGGTTTCTCGAGAAACCCATGTGGTACCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-3445s21c1
Sequence:CCGGCTGTCACCAGTGATCCGTAGACTCGAGTCTACGGATCACTGGTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206920
MAMDC4 MISSION shRNA shRNA Plasmid DNA
MAM domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1077s1c1
Sequence:CCGGGTCTTCTATCAGTACCTGAGTCTCGAGACTCAGGTACTGATAGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-3126s1c1
Sequence:CCGGGAGTTCCAGATCGTGTTTGAACTCGAGTTCAAACACGATCTGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1731s1c1
Sequence:CCGGGAACTCCACCTGGCTTATTATCTCGAGATAATAAGCCAGGTGGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-1781s21c1
Sequence:CCGGTAACTTTGAGCGGGACACATGCTCGAGCATGTGTCCCGCTCAAAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-821s21c1
Sequence:CCGGGTCTGATGAGAACCCACTCACCTCGAGGTGAGTGGGTTCTCATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206920.2-3490s21c1
Sequence:CCGGCTCACGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-2972s1c1
Sequence:CCGGCTTCTGGTACCACATGGGTTTCTCGAGAAACCCATGTGGTACCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-3445s21c1
Sequence:CCGGCTGTCACCAGTGATCCGTAGACTCGAGTCTACGGATCACTGGTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206920
MAMDC4 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1077s1c1
Sequence:CCGGGTCTTCTATCAGTACCTGAGTCTCGAGACTCAGGTACTGATAGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-3126s1c1
Sequence:CCGGGAGTTCCAGATCGTGTTTGAACTCGAGTTCAAACACGATCTGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-1731s1c1
Sequence:CCGGGAACTCCACCTGGCTTATTATCTCGAGATAATAAGCCAGGTGGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-1781s21c1
Sequence:CCGGTAACTTTGAGCGGGACACATGCTCGAGCATGTGTCCCGCTCAAAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-821s21c1
Sequence:CCGGGTCTGATGAGAACCCACTCACCTCGAGGTGAGTGGGTTCTCATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206920.2-3490s21c1
Sequence:CCGGCTCACGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206920.1-2972s1c1
Sequence:CCGGCTTCTGGTACCACATGGGTTTCTCGAGAAACCCATGTGGTACCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206920.2-3445s21c1
Sequence:CCGGCTGTCACCAGTGATCCGTAGACTCGAGTCTACGGATCACTGGTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081199
MAMDC4 MISSION shRNA Bacterial Glycerol Stock
MAM domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081199.1-3803s21c1
Sequence:CCGGGCATCTCTTGCAGCATCTAAACTCGAGTTTAGATGCTGCAAGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-271s21c1
Sequence:CCGGTTCCATGGAGCCTCAACTATCCTCGAGGATAGTTGAGGCTCCATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-2142s21c1
Sequence:CCGGTGCCCACTGGCACCGTATAAACTCGAGTTTATACGGTGCCAGTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-433s21c1
Sequence:CCGGACTGACTTGGGCTGGTATATGCTCGAGCATATACCAGCCCAAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-1132s21c1
Sequence:CCGGTGCTCGTTCACCTTCTATTACCTCGAGGTAATAGAAGGTGAACGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081199
MAMDC4 MISSION shRNA shRNA Plasmid DNA
MAM domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081199.1-3803s21c1
Sequence:CCGGGCATCTCTTGCAGCATCTAAACTCGAGTTTAGATGCTGCAAGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-271s21c1
Sequence:CCGGTTCCATGGAGCCTCAACTATCCTCGAGGATAGTTGAGGCTCCATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-2142s21c1
Sequence:CCGGTGCCCACTGGCACCGTATAAACTCGAGTTTATACGGTGCCAGTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-433s21c1
Sequence:CCGGACTGACTTGGGCTGGTATATGCTCGAGCATATACCAGCCCAAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-1132s21c1
Sequence:CCGGTGCTCGTTCACCTTCTATTACCTCGAGGTAATAGAAGGTGAACGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081199
MAMDC4 MISSION shRNA Lentiviral Transduction Particles
MAM domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081199.1-3803s21c1
Sequence:CCGGGCATCTCTTGCAGCATCTAAACTCGAGTTTAGATGCTGCAAGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-271s21c1
Sequence:CCGGTTCCATGGAGCCTCAACTATCCTCGAGGATAGTTGAGGCTCCATGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-2142s21c1
Sequence:CCGGTGCCCACTGGCACCGTATAAACTCGAGTTTATACGGTGCCAGTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-433s21c1
Sequence:CCGGACTGACTTGGGCTGGTATATGCTCGAGCATATACCAGCCCAAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081199.1-1132s21c1
Sequence:CCGGTGCTCGTTCACCTTCTATTACCTCGAGGTAATAGAAGGTGAACGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)