EMAIL THIS PAGE TO A FRIEND

MAML1

mastermind-like 1 (Drosophila)

158 Gene Product Result for
Synonyms: Mam-1 Mam1
UniProtKB ID: Q92585, Q9NZ12
Gene ID:
Human(9794) Summary: This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(103806) mastermind like 1 (Drosophila)
Rat(303101) mastermind like 1 (Drosophila)
chicken(416286) mastermind-like 1 (Drosophila)
cow(100336926) mastermind-like 1 (Drosophila)
Horse(100067311) mastermind-like 1 (Drosophila)
domestic cat(101096441) mastermind-like 1 (Drosophila)
dog(481457) mastermind-like 1 (Drosophila)
domestic guinea pig(100725960) mastermind-like 1 (Drosophila)
naked mole-rat(101721888) mastermind-like 1 (Drosophila)
Domestic Rabbit(100356351) mastermind-like 1 (Drosophila)
sheep(101119558) mastermind-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014757 Rosetta Predictions human pricing
NM_001106997 Rosetta Predictions rat pricing
NM_175334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224163 predicted 3306
2 SASI_Hs01_00224164 predicted 1950
3 SASI_Hs01_00224165 predicted 1648
4 SASI_Hs01_00224167 predicted 2235
5 SASI_Hs02_00346229 predicted 1650
6 SASI_Hs01_00224170 predicted 1743
7 SASI_Hs01_00224171 predicted 1179
8 SASI_Hs01_00224172 predicted 1898
9 SASI_Hs02_00346230 predicted 2594
10 SASI_Hs02_00346231 predicted 2587
11 SASI_Hs01_00224166 predicted 3338
12 SASI_Hs01_00224168 predicted 3387
13 SASI_Hs01_00224169 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224466 predicted 3267
2 SASI_Rn02_00224467 predicted 1752
3 SASI_Rn02_00224468 predicted 1791
4 SASI_Rn02_00224469 predicted 2599
5 SASI_Rn02_00224470 predicted 1759
6 SASI_Rn02_00224471 predicted 3319
7 SASI_Rn02_00224472 predicted 3326
8 SASI_Rn02_00224473 predicted 1192
9 SASI_Rn02_00224474 predicted 3272
10 SASI_Rn02_00224475 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346127 predicted 1772
2 SASI_Mm01_00189783 predicted 1222
3 SASI_Mm01_00189784 predicted 3394
4 SASI_Mm01_00189785 predicted 1358
5 SASI_Mm01_00189786 predicted 3353
6 SASI_Mm02_00346128 predicted 919
7 SASI_Mm01_00189788 predicted 3297
8 SASI_Mm01_00189789 predicted 1663
9 SASI_Mm01_00189791 predicted 1681
10 SASI_Mm02_00346129 predicted 1942
11 SASI_Mm01_00189787 predicted 1151
12 SASI_Mm01_00189790 predicted 336
13 SASI_Mm01_00189792 predicted 2677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175334
VALIDATED
MAML1 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1017s21c1
Sequence:CCGGATGCCGGACCTCAACCTTAATCTCGAGATTAAGGTTGAGGTCCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-3297s21c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1940s21c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-3187s1c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1989s1c1
Sequence:CCGGCCTGGTTTAACAAAGCCACAACTCGAGTTGTGGCTTTGTTAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1187s1c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175334.2-2544s1c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1772s21c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175334.3-3940s21c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1019s1c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175334
VALIDATED
MAML1 MISSION shRNA shRNA Plasmid DNA
mastermind-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1017s21c1
Sequence:CCGGATGCCGGACCTCAACCTTAATCTCGAGATTAAGGTTGAGGTCCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-3297s21c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1940s21c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-3187s1c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1989s1c1
Sequence:CCGGCCTGGTTTAACAAAGCCACAACTCGAGTTGTGGCTTTGTTAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1187s1c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175334.2-2544s1c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1772s21c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175334.3-3940s21c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1019s1c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175334
VALIDATED
MAML1 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1017s21c1
Sequence:CCGGATGCCGGACCTCAACCTTAATCTCGAGATTAAGGTTGAGGTCCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-3297s21c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1940s21c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-3187s1c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1989s1c1
Sequence:CCGGCCTGGTTTAACAAAGCCACAACTCGAGTTGTGGCTTTGTTAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1187s1c1
Sequence:CCGGCCATCTGAGTAACGAGCAGAACTCGAGTTCTGCTCGTTACTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175334.2-2544s1c1
Sequence:CCGGGAGTGGATCAATGAATTGGATCTCGAGATCCAATTCATTGATCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175334.3-1772s21c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175334.3-3940s21c1
Sequence:CCGGCCCTCCTGAAATCTCCTACTTCTCGAGAAGTAGGAGATTTCAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175334.2-1019s1c1
Sequence:CCGGCCAGTCACCAAGTAACTTGAACTCGAGTTCAAGTTACTTGGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014757
VALIDATED
MAML1 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 1 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-585s1c1
Sequence:CCGGCATGATACAGTTAAGAGGAATCTCGAGATTCCTCTTAACTGTATCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1790s1c1
Sequence:CCGGGCTGGACTACGGCAATACAAACTCGAGTTTGTATTGCCGTAGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014757.x-4743s1c1
Sequence:CCGGCCTATGTGAGAATTGAGCCAACTCGAGTTGGCTCAATTCTCACATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-965s1c1
Sequence:CCGGCATATCGCAAAGCAACCTCATCTCGAGATGAGGTTGCTTTGCGATATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1907s1c1
Sequence:CCGGCCATATAAGTCACGAGCAGAACTCGAGTTCTGCTCGTGACTTATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014757
VALIDATED
MAML1 MISSION shRNA shRNA Plasmid DNA
mastermind-like 1 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-585s1c1
Sequence:CCGGCATGATACAGTTAAGAGGAATCTCGAGATTCCTCTTAACTGTATCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1790s1c1
Sequence:CCGGGCTGGACTACGGCAATACAAACTCGAGTTTGTATTGCCGTAGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014757.x-4743s1c1
Sequence:CCGGCCTATGTGAGAATTGAGCCAACTCGAGTTGGCTCAATTCTCACATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-965s1c1
Sequence:CCGGCATATCGCAAAGCAACCTCATCTCGAGATGAGGTTGCTTTGCGATATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1907s1c1
Sequence:CCGGCCATATAAGTCACGAGCAGAACTCGAGTTCTGCTCGTGACTTATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014757
VALIDATED
MAML1 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 1 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-585s1c1
Sequence:CCGGCATGATACAGTTAAGAGGAATCTCGAGATTCCTCTTAACTGTATCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1790s1c1
Sequence:CCGGGCTGGACTACGGCAATACAAACTCGAGTTTGTATTGCCGTAGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014757.x-4743s1c1
Sequence:CCGGCCTATGTGAGAATTGAGCCAACTCGAGTTGGCTCAATTCTCACATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-965s1c1
Sequence:CCGGCATATCGCAAAGCAACCTCATCTCGAGATGAGGTTGCTTTGCGATATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014757.x-1907s1c1
Sequence:CCGGCCATATAAGTCACGAGCAGAACTCGAGTTCTGCTCGTGACTTATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)