EMAIL THIS PAGE TO A FRIEND

MAML2

mastermind-like 2 (Drosophila)

122 Gene Product Result for
Synonyms: MAM-3 MAM2 MAM3 MLL-MAML2
UniProtKB ID: Q8IZL2, A7MD26, Q6AI23, Q6Y3A3, Q8IUL3, Q96JK6
Gene ID:
Mouse(270118) mastermind like 2 (Drosophila)
Rat(689844) mastermind like 2 (Drosophila)
sheep(101102586) mastermind-like 2 (Drosophila)
Domestic Rabbit(100345650) mastermind-like 2 (Drosophila)
naked mole-rat(101721053) mastermind-like 2 (Drosophila)
domestic guinea pig(100722455) mastermind-like 2 (Drosophila)
chicken(428088) mastermind-like 2 (Drosophila)
cow(521194) mastermind-like 2 (Drosophila)
Horse(100067991) mastermind-like 2 (Drosophila)
domestic cat(101101664) mastermind-like 2 (Drosophila)
dog(485116) mastermind-like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001473154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001473154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001473154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032427 Rosetta Predictions human pricing
XM_001072241 Rosetta Predictions rat pricing
NM_001013813 Rosetta Predictions mouse pricing
XM_001473154 Rosetta Predictions mouse pricing
XM_001481278 Rosetta Predictions mouse pricing
XM_486185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184002 predicted 3820
2 SASI_Hs01_00184003 predicted 3759
3 SASI_Hs01_00184004 predicted 4171
4 SASI_Hs01_00184005 predicted 4638
5 SASI_Hs01_00184006 predicted 3709
6 SASI_Hs02_00359833 predicted 2064
7 SASI_Hs01_00184007 predicted 3748
8 SASI_Hs01_00184008 predicted 4812
9 SASI_Hs01_00184009 predicted 4208
10 SASI_Hs02_00359834 predicted 1941
11 SASI_Hs01_00184010 predicted 1959
12 SASI_Hs01_00184011 predicted 4706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338361 predicted 2549
2 SASI_Rn02_00338362 predicted 3210
3 SASI_Rn02_00338363 predicted 3136
4 SASI_Rn02_00338364 predicted 3150
5 SASI_Rn02_00338365 predicted 2726
6 SASI_Rn02_00338366 predicted 3112
7 SASI_Rn02_00338367 predicted 2759
8 SASI_Rn02_00338368 predicted 2746
9 SASI_Rn02_00338369 predicted 2638
10 SASI_Rn02_00338370 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287380 predicted 2803
2 SASI_Mm02_00287381 predicted 2626
3 SASI_Mm02_00287382 predicted 851
4 SASI_Mm02_00287383 predicted 1080
5 SASI_Mm02_00287384 predicted 2970
6 SASI_Mm02_00287385 predicted 200
7 SASI_Mm02_00287386 predicted 272
8 SASI_Mm02_00287387 predicted 2911
9 SASI_Mm02_00287388 predicted 1092
10 SASI_Mm02_00287389 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00366332 predicted 2795
2 SASI_Mm02_00366333 predicted 2629
3 SASI_Mm02_00366334 predicted 844
4 SASI_Mm02_00366335 predicted 1079
5 SASI_Mm02_00366336 predicted 2966
6 SASI_Mm02_00366337 predicted 203
7 SASI_Mm02_00366338 predicted 268
8 SASI_Mm02_00366339 predicted 2914
9 SASI_Mm02_00366340 predicted 1090
10 SASI_Mm02_00366341 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423354 predicted 679
2 SASI_Mm02_00423355 predicted 678
3 SASI_Mm02_00423356 predicted 717
4 SASI_Mm02_00423357 predicted 716
5 SASI_Mm02_00423358 predicted 681
6 SASI_Mm02_00423359 predicted 682
7 SASI_Mm02_00423360 predicted 681
8 SASI_Mm02_00423361 predicted 683
9 SASI_Mm02_00423362 predicted 708
10 SASI_Mm02_00423363 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207607 predicted 2322
2 SASI_Mm01_00207608 predicted 2261
3 SASI_Mm01_00207609 predicted 2152
4 SASI_Mm01_00207610 predicted 377
5 SASI_Mm01_00207611 predicted 599
6 SASI_Mm01_00207612 predicted 2499
7 SASI_Mm01_00207613 predicted 2760
8 SASI_Mm01_00207614 predicted 618
9 SASI_Mm01_00207615 predicted 1890
10 SASI_Mm01_00207616 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032427
VALIDATED
MAML2 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-4970s1c1
Sequence:CCGGCCCTGTCTAAACTCCAGGATACTCGAGTATCCTGGAGTTTAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4383s1c1
Sequence:CCGGGCCAAACACTAAATGGGCAAACTCGAGTTTGCCCATTTAGTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4130s1c1
Sequence:CCGGCCACAGAGAACATCAAACGTACTCGAGTACGTTTGATGTTCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-3970s1c1
Sequence:CCGGCCCAAAGCAATTGTTAGCAAACTCGAGTTTGCTAACAATTGCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-2053s1c1
Sequence:CCGGCCTGTTTAACATGGGCTTAAACTCGAGTTTAAGCCCATGTTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2691s21c1
Sequence:CCGGGACCATCACCAGGTCCATTTGCTCGAGCAAATGGACCTGGTGATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4021s21c1
Sequence:CCGGTACCTTAGGGCCAAGTAATAACTCGAGTTATTACTTGGCCCTAAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4984s21c1
Sequence:CCGGCAGGATACAGTATCCAATTTACTCGAGTAAATTGGATACTGTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-3671s21c1
Sequence:CCGGAGGCCACCTCCAGATTATAAACTCGAGTTTATAATCTGGAGGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2214s21c1
Sequence:CCGGTCAATGAACTGACCAACATATCTCGAGATATGTTGGTCAGTTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032427
VALIDATED
MAML2 MISSION shRNA shRNA Plasmid DNA
mastermind-like 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-4970s1c1
Sequence:CCGGCCCTGTCTAAACTCCAGGATACTCGAGTATCCTGGAGTTTAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4383s1c1
Sequence:CCGGGCCAAACACTAAATGGGCAAACTCGAGTTTGCCCATTTAGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4130s1c1
Sequence:CCGGCCACAGAGAACATCAAACGTACTCGAGTACGTTTGATGTTCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-3970s1c1
Sequence:CCGGCCCAAAGCAATTGTTAGCAAACTCGAGTTTGCTAACAATTGCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-2053s1c1
Sequence:CCGGCCTGTTTAACATGGGCTTAAACTCGAGTTTAAGCCCATGTTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2691s21c1
Sequence:CCGGGACCATCACCAGGTCCATTTGCTCGAGCAAATGGACCTGGTGATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4021s21c1
Sequence:CCGGTACCTTAGGGCCAAGTAATAACTCGAGTTATTACTTGGCCCTAAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4984s21c1
Sequence:CCGGCAGGATACAGTATCCAATTTACTCGAGTAAATTGGATACTGTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-3671s21c1
Sequence:CCGGAGGCCACCTCCAGATTATAAACTCGAGTTTATAATCTGGAGGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2214s21c1
Sequence:CCGGTCAATGAACTGACCAACATATCTCGAGATATGTTGGTCAGTTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032427
VALIDATED
MAML2 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-4970s1c1
Sequence:CCGGCCCTGTCTAAACTCCAGGATACTCGAGTATCCTGGAGTTTAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4383s1c1
Sequence:CCGGGCCAAACACTAAATGGGCAAACTCGAGTTTGCCCATTTAGTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-4130s1c1
Sequence:CCGGCCACAGAGAACATCAAACGTACTCGAGTACGTTTGATGTTCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032427.1-3970s1c1
Sequence:CCGGCCCAAAGCAATTGTTAGCAAACTCGAGTTTGCTAACAATTGCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032427.1-2053s1c1
Sequence:CCGGCCTGTTTAACATGGGCTTAAACTCGAGTTTAAGCCCATGTTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2691s21c1
Sequence:CCGGGACCATCACCAGGTCCATTTGCTCGAGCAAATGGACCTGGTGATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4021s21c1
Sequence:CCGGTACCTTAGGGCCAAGTAATAACTCGAGTTATTACTTGGCCCTAAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032427.1-4984s21c1
Sequence:CCGGCAGGATACAGTATCCAATTTACTCGAGTAAATTGGATACTGTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-3671s21c1
Sequence:CCGGAGGCCACCTCCAGATTATAAACTCGAGTTTATAATCTGGAGGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032427.1-2214s21c1
Sequence:CCGGTCAATGAACTGACCAACATATCTCGAGATATGTTGGTCAGTTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001473154
MAML2 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1711s21c1
Sequence:CCGGCAATCGAAGCTTCATTAATAACTCGAGTTATTAATGAAGCTTCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1618s21c1
Sequence:CCGGGTCTAAAGCAGCGGCCAATTACTCGAGTAATTGGCCGCTGCTTTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1021s21c1
Sequence:CCGGCAATGAACTAACCAACATATCCTCGAGGATATGTTGGTTAGTTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3446s21c1
Sequence:CCGGCCTGATCATGGCAGTGATTTACTCGAGTAAATCACTGCCATGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4335s21c1
Sequence:CCGGCAACAGCCTGTATCGAATTTCCTCGAGGAAATTCGATACAGGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-2611s21c1
Sequence:GTACCGGCTCCTCTACAGTGAGTTTAAACTCGAGTTTAAACTCACTGTAGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4115s21c1
Sequence:CCGGGAAGCTATCCAGCAGATTAATCTCGAGATTAATCTGCTGGATAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3238s21c1
Sequence:CCGGCCAAATGAATCAGGCATTAAACTCGAGTTTAATGCCTGATTCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1075s21c1
Sequence:CCGGCATGATCAATGCTACCATTAACTCGAGTTAATGGTAGCATTGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1161s21c1
Sequence:CCGGTGCCCATGGAGAAGATCATTACTCGAGTAATGATCTTCTCCATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001473154
MAML2 MISSION shRNA shRNA Plasmid DNA
mastermind-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1711s21c1
Sequence:CCGGCAATCGAAGCTTCATTAATAACTCGAGTTATTAATGAAGCTTCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1618s21c1
Sequence:CCGGGTCTAAAGCAGCGGCCAATTACTCGAGTAATTGGCCGCTGCTTTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1021s21c1
Sequence:CCGGCAATGAACTAACCAACATATCCTCGAGGATATGTTGGTTAGTTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3446s21c1
Sequence:CCGGCCTGATCATGGCAGTGATTTACTCGAGTAAATCACTGCCATGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4335s21c1
Sequence:CCGGCAACAGCCTGTATCGAATTTCCTCGAGGAAATTCGATACAGGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-2611s21c1
Sequence:GTACCGGCTCCTCTACAGTGAGTTTAAACTCGAGTTTAAACTCACTGTAGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4115s21c1
Sequence:CCGGGAAGCTATCCAGCAGATTAATCTCGAGATTAATCTGCTGGATAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3238s21c1
Sequence:CCGGCCAAATGAATCAGGCATTAAACTCGAGTTTAATGCCTGATTCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1075s21c1
Sequence:CCGGCATGATCAATGCTACCATTAACTCGAGTTAATGGTAGCATTGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1161s21c1
Sequence:CCGGTGCCCATGGAGAAGATCATTACTCGAGTAATGATCTTCTCCATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001473154
MAML2 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1711s21c1
Sequence:CCGGCAATCGAAGCTTCATTAATAACTCGAGTTATTAATGAAGCTTCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1618s21c1
Sequence:CCGGGTCTAAAGCAGCGGCCAATTACTCGAGTAATTGGCCGCTGCTTTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1021s21c1
Sequence:CCGGCAATGAACTAACCAACATATCCTCGAGGATATGTTGGTTAGTTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3446s21c1
Sequence:CCGGCCTGATCATGGCAGTGATTTACTCGAGTAAATCACTGCCATGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4335s21c1
Sequence:CCGGCAACAGCCTGTATCGAATTTCCTCGAGGAAATTCGATACAGGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-2611s21c1
Sequence:GTACCGGCTCCTCTACAGTGAGTTTAAACTCGAGTTTAAACTCACTGTAGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001473154.1-4115s21c1
Sequence:CCGGGAAGCTATCCAGCAGATTAATCTCGAGATTAATCTGCTGGATAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-3238s21c1
Sequence:CCGGCCAAATGAATCAGGCATTAAACTCGAGTTTAATGCCTGATTCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1075s21c1
Sequence:CCGGCATGATCAATGCTACCATTAACTCGAGTTAATGGTAGCATTGATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473154.1-1161s21c1
Sequence:CCGGTGCCCATGGAGAAGATCATTACTCGAGTAATGATCTTCTCCATGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)