EMAIL THIS PAGE TO A FRIEND

MAML3

mastermind-like 3 (Drosophila)

104 Gene Product Result for
Synonyms: CAGH3 ERDA3 GDN MAM-2 MAM2 TNRC3
UniProtKB ID: Q96JK9, B2RNU9, B3KVV7
Gene ID:
Mouse(433586) mastermind like 3 (Drosophila)
Rat(310405) mastermind like 3 (Drosophila)
chicken(422445) mastermind-like 3 (Drosophila)
cow(540588) mastermind-like 3 (Drosophila)
Horse(100063201) mastermind-like 3 (Drosophila)
domestic cat(101090687) mastermind-like 3 (Drosophila)
dog(483814) mastermind-like 3 (Drosophila)
domestic guinea pig(100719538) mastermind-like 3 (Drosophila)
naked mole-rat(101717113) mastermind-like 3 (Drosophila)
sheep(101115315) mastermind-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018717 Rosetta Predictions human pricing
NM_001107675 Rosetta Predictions rat pricing
NM_001004176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028762 predicted 1255
2 SASI_Hs01_00028763 predicted 3665
3 SASI_Hs01_00028764 predicted 1236
4 SASI_Hs01_00028766 predicted 3371
5 SASI_Hs01_00028767 predicted 1408
6 SASI_Hs01_00028769 predicted 1465
7 SASI_Hs02_00352255 predicted 1308
8 SASI_Hs02_00352256 predicted 3665
9 SASI_Hs02_00352257 predicted 1215
10 SASI_Hs02_00352258 predicted 1556
11 SASI_Hs01_00028765 predicted 1565
12 SASI_Hs01_00028768 predicted 1619
13 SASI_Hs01_00028770 predicted 1415
14 SASI_Hs01_00028771 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231165 predicted 2297
2 SASI_Rn02_00231166 predicted 2091
3 SASI_Rn02_00231167 predicted 1953
4 SASI_Rn02_00231168 predicted 2101
5 SASI_Rn02_00231169 predicted 1906
6 SASI_Rn02_00231170 predicted 1583
7 SASI_Rn02_00231171 predicted 1953
8 SASI_Rn02_00231172 predicted 2100
9 SASI_Rn02_00231173 predicted 2233
10 SASI_Rn02_00231174 predicted 1754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032094 predicted 1858
2 SASI_Mm01_00032095 predicted 1674
3 SASI_Mm01_00032096 predicted 1399
4 SASI_Mm01_00032097 predicted 1572
5 SASI_Mm01_00032098 predicted 1808
6 SASI_Mm01_00032099 predicted 1945
7 SASI_Mm02_00286495 predicted 1628
8 SASI_Mm01_00032100 predicted 2006
9 SASI_Mm01_00032101 predicted 1975
10 SASI_Mm01_00032102 predicted 1959
11 SASI_Mm01_00032103 predicted 1798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004176
MAML3 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-891s21c1
Sequence:CCGGGCCGCGAATGGTAGTAGTATCCTCGAGGATACTACTACCATTCGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-3322s21c1
Sequence:CCGGTGCGAGCATCGAGGTTGATTGCTCGAGCAATCAACCTCGATGCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-402s1c1
Sequence:CCGGGAAGACGACCATGAACAACTACTCGAGTAGTTGTTCATGGTCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004176.1-2252s1c1
Sequence:CCGGCGTAAATTGAGAACATGACATCTCGAGATGTCATGTTCTCAATTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-4060s21c1
Sequence:CCGGAGATAGCAGGTGGCAACTTTGCTCGAGCAAAGTTGCCACCTGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-2580s21c1
Sequence:CCGGTTGGGTACAAACTCCTTAAACCTCGAGGTTTAAGGAGTTTGTACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004176.2-5329s21c1
Sequence:CCGGGATAGGACCTGCCGGTTTATACTCGAGTATAAACCGGCAGGTCCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-353s1c1
Sequence:CCGGCCTTTAACAACCAAAGCACTACTCGAGTAGTGCTTTGGTTGTTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004176
MAML3 MISSION shRNA shRNA Plasmid DNA
mastermind-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-891s21c1
Sequence:CCGGGCCGCGAATGGTAGTAGTATCCTCGAGGATACTACTACCATTCGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-3322s21c1
Sequence:CCGGTGCGAGCATCGAGGTTGATTGCTCGAGCAATCAACCTCGATGCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-402s1c1
Sequence:CCGGGAAGACGACCATGAACAACTACTCGAGTAGTTGTTCATGGTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004176.1-2252s1c1
Sequence:CCGGCGTAAATTGAGAACATGACATCTCGAGATGTCATGTTCTCAATTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-4060s21c1
Sequence:CCGGAGATAGCAGGTGGCAACTTTGCTCGAGCAAAGTTGCCACCTGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-2580s21c1
Sequence:CCGGTTGGGTACAAACTCCTTAAACCTCGAGGTTTAAGGAGTTTGTACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004176.2-5329s21c1
Sequence:CCGGGATAGGACCTGCCGGTTTATACTCGAGTATAAACCGGCAGGTCCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-353s1c1
Sequence:CCGGCCTTTAACAACCAAAGCACTACTCGAGTAGTGCTTTGGTTGTTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004176
MAML3 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 3 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-891s21c1
Sequence:CCGGGCCGCGAATGGTAGTAGTATCCTCGAGGATACTACTACCATTCGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-3322s21c1
Sequence:CCGGTGCGAGCATCGAGGTTGATTGCTCGAGCAATCAACCTCGATGCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-402s1c1
Sequence:CCGGGAAGACGACCATGAACAACTACTCGAGTAGTTGTTCATGGTCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004176.1-2252s1c1
Sequence:CCGGCGTAAATTGAGAACATGACATCTCGAGATGTCATGTTCTCAATTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-4060s21c1
Sequence:CCGGAGATAGCAGGTGGCAACTTTGCTCGAGCAAAGTTGCCACCTGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004176.2-2580s21c1
Sequence:CCGGTTGGGTACAAACTCCTTAAACCTCGAGGTTTAAGGAGTTTGTACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004176.2-5329s21c1
Sequence:CCGGGATAGGACCTGCCGGTTTATACTCGAGTATAAACCGGCAGGTCCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004176.1-353s1c1
Sequence:CCGGCCTTTAACAACCAAAGCACTACTCGAGTAGTGCTTTGGTTGTTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018717
VALIDATED
MAML3 MISSION shRNA Bacterial Glycerol Stock
mastermind-like 3 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018717.4-6259s21c1
Sequence:CCGGAGTACTGGGACCAACTAATAGCTCGAGCTATTAGTTGGTCCCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1463s21c1
Sequence:CCGGTGGGCTTCTAGAAGATCTAAGCTCGAGCTTAGATCTTCTAGAAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1251s21c1
Sequence:CCGGGGAGCTCGATCACCACTTAATCTCGAGATTAAGTGGTGATCGAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-2471s21c1
Sequence:CCGGGATCAATCAGCAGCCAAATAACTCGAGTTATTTGGCTGCTGATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018717.2-2371s1c1
Sequence:CCGGCCCAAGCCTTTAACAACCAAACTCGAGTTTGGTTGTTAAAGGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018717.4-780s21c1
Sequence:CCGGGCCGCGAATGGCAGTAGTATTCTCGAGAATACTACTGCCATTCGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-3160s1c1
Sequence:CCGGCCCAGGATATAGCAGCCGTAACTCGAGTTACGGCTGCTATATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-1358s1c1
Sequence:CCGGCATCAACAATTTGCCCAGTAACTCGAGTTACTGGGCAAATTGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018717
VALIDATED
MAML3 MISSION shRNA shRNA Plasmid DNA
mastermind-like 3 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018717.4-6259s21c1
Sequence:CCGGAGTACTGGGACCAACTAATAGCTCGAGCTATTAGTTGGTCCCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1463s21c1
Sequence:CCGGTGGGCTTCTAGAAGATCTAAGCTCGAGCTTAGATCTTCTAGAAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1251s21c1
Sequence:CCGGGGAGCTCGATCACCACTTAATCTCGAGATTAAGTGGTGATCGAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-2471s21c1
Sequence:CCGGGATCAATCAGCAGCCAAATAACTCGAGTTATTTGGCTGCTGATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018717.2-2371s1c1
Sequence:CCGGCCCAAGCCTTTAACAACCAAACTCGAGTTTGGTTGTTAAAGGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018717.4-780s21c1
Sequence:CCGGGCCGCGAATGGCAGTAGTATTCTCGAGAATACTACTGCCATTCGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-3160s1c1
Sequence:CCGGCCCAGGATATAGCAGCCGTAACTCGAGTTACGGCTGCTATATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-1358s1c1
Sequence:CCGGCATCAACAATTTGCCCAGTAACTCGAGTTACTGGGCAAATTGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018717
VALIDATED
MAML3 MISSION shRNA Lentiviral Transduction Particles
mastermind-like 3 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018717.4-6259s21c1
Sequence:CCGGAGTACTGGGACCAACTAATAGCTCGAGCTATTAGTTGGTCCCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1463s21c1
Sequence:CCGGTGGGCTTCTAGAAGATCTAAGCTCGAGCTTAGATCTTCTAGAAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-1251s21c1
Sequence:CCGGGGAGCTCGATCACCACTTAATCTCGAGATTAAGTGGTGATCGAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018717.4-2471s21c1
Sequence:CCGGGATCAATCAGCAGCCAAATAACTCGAGTTATTTGGCTGCTGATTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018717.2-2371s1c1
Sequence:CCGGCCCAAGCCTTTAACAACCAAACTCGAGTTTGGTTGTTAAAGGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018717.4-780s21c1
Sequence:CCGGGCCGCGAATGGCAGTAGTATTCTCGAGAATACTACTGCCATTCGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-3160s1c1
Sequence:CCGGCCCAGGATATAGCAGCCGTAACTCGAGTTACGGCTGCTATATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018717.2-1358s1c1
Sequence:CCGGCATCAACAATTTGCCCAGTAACTCGAGTTACTGGGCAAATTGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)