EMAIL THIS PAGE TO A FRIEND

MAMSTR

MEF2 activating motif and SAP domain containing transcriptional regulator

92 Gene Product Result for
Synonyms: MASTR
UniProtKB ID: Q6ZN01, B7ZKX4, Q3KQU9, Q8N9Y3
Gene ID:
Mouse(74490) MEF2 activating motif and SAP domain containing transcriptional regulator
Rat(691041) MEF2 activating motif and SAP domain containing transcriptional regulator
cow(505540) MEF2 activating motif and SAP domain containing transcriptional regulator
domestic cat(101085961) MEF2 activating motif and SAP domain containing transcriptional regulator
dog(612016) MEF2 activating motif and SAP domain containing transcriptional regulator
domestic guinea pig(100731916) MEF2 activating motif and SAP domain containing transcriptional regulator
naked mole-rat(101719354) MEF2 activating motif and SAP domain containing transcriptional regulator
sheep(101107726) MEF2 activating motif and SAP domain containing transcriptional regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001476117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001476117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001476117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182574 Rosetta Predictions human pricing
XM_001076631 Rosetta Predictions rat pricing
NM_172418 Rosetta Predictions mouse pricing
XM_001476117 Rosetta Predictions mouse pricing
XM_001476874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241026 predicted 1538
2 SASI_Hs01_00241027 predicted 1532
3 SASI_Hs01_00241029 predicted 1540
4 SASI_Hs01_00241030 predicted 1529
5 SASI_Hs01_00241031 predicted 680
6 SASI_Hs01_00241032 predicted 1554
7 SASI_Hs01_00241033 predicted 1519
8 SASI_Hs01_00241034 predicted 783
9 SASI_Hs01_00241035 predicted 1334
10 SASI_Hs02_00370703 predicted 793
11 SASI_Hs01_00241028 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353944 predicted 293
2 SASI_Rn02_00353945 predicted 478
3 SASI_Rn02_00353946 predicted 471
4 SASI_Rn02_00353947 predicted 817
5 SASI_Rn02_00353948 predicted 372
6 SASI_Rn02_00353949 predicted 457
7 SASI_Rn02_00353950 predicted 252
8 SASI_Rn02_00353951 predicted 555
9 SASI_Rn02_00353952 predicted 712
10 SASI_Rn02_00353953 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056475 predicted 1741
2 SASI_Mm01_00056476 predicted 1333
3 SASI_Mm01_00056477 predicted 1319
4 SASI_Mm01_00056478 predicted 1595
5 SASI_Mm01_00056479 predicted 964
6 SASI_Mm01_00056480 predicted 721
7 SASI_Mm01_00056481 predicted 1125
8 SASI_Mm01_00056482 predicted 1731
9 SASI_Mm01_00056483 predicted 1305
10 SASI_Mm01_00056484 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387077 predicted 823
2 SASI_Mm02_00387078 predicted 814
3 SASI_Mm02_00387079 predicted 831
4 SASI_Mm02_00387080 predicted 973
5 SASI_Mm02_00387081 predicted 813
6 SASI_Mm02_00387082 predicted 828
7 SASI_Mm02_00387083 predicted 989
8 SASI_Mm02_00387084 predicted 975
9 SASI_Mm02_00387085 predicted 797
10 SASI_Mm02_00387086 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391876 predicted 438
2 SASI_Mm02_00391877 predicted 1375
3 SASI_Mm02_00391878 predicted 413
4 SASI_Mm02_00391879 predicted 1234
5 SASI_Mm02_00391880 predicted 1310
6 SASI_Mm02_00391881 predicted 1427
7 SASI_Mm02_00391882 predicted 1395
8 SASI_Mm02_00391883 predicted 574
9 SASI_Mm02_00391884 predicted 829
10 SASI_Mm02_00391885 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182574
MAMSTR MISSION shRNA Bacterial Glycerol Stock
MEF2 activating motif and SAP domain containing transcriptional regulator
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1206s21c1
Sequence:CCGGGAGGGCGCAGTTGCTTCCTAACTCGAGTTAGGAAGCAACTGCGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1484s21c1
Sequence:CCGGGCATCTTCTCCGCTGACTTATCTCGAGATAAGTCAGCGGAGAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1549s21c1
Sequence:CCGGTGGTGATGGATTCTAGGATTTCTCGAGAAATCCTAGAATCCATCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-798s1c1
Sequence:CCGGGTTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-802s1c1
Sequence:CCGGGAACTTCAGACCCTTAAACTGCTCGAGCAGTTTAAGGGTCTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-789s1c1
Sequence:CCGGCCCACACAAGTTGGAACTTCACTCGAGTGAAGTTCCAACTTGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-1337s1c1
Sequence:CCGGCTGAAGGCCTCTCATCTGTTTCTCGAGAAACAGATGAGAGGCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-795s1c1
Sequence:CCGGCAAGTTGGAACTTCAGACCCTCTCGAGAGGGTCTGAAGTTCCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182574
MAMSTR MISSION shRNA shRNA Plasmid DNA
MEF2 activating motif and SAP domain containing transcriptional regulator
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1206s21c1
Sequence:CCGGGAGGGCGCAGTTGCTTCCTAACTCGAGTTAGGAAGCAACTGCGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1484s21c1
Sequence:CCGGGCATCTTCTCCGCTGACTTATCTCGAGATAAGTCAGCGGAGAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1549s21c1
Sequence:CCGGTGGTGATGGATTCTAGGATTTCTCGAGAAATCCTAGAATCCATCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-798s1c1
Sequence:CCGGGTTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-802s1c1
Sequence:CCGGGAACTTCAGACCCTTAAACTGCTCGAGCAGTTTAAGGGTCTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-789s1c1
Sequence:CCGGCCCACACAAGTTGGAACTTCACTCGAGTGAAGTTCCAACTTGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-1337s1c1
Sequence:CCGGCTGAAGGCCTCTCATCTGTTTCTCGAGAAACAGATGAGAGGCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-795s1c1
Sequence:CCGGCAAGTTGGAACTTCAGACCCTCTCGAGAGGGTCTGAAGTTCCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182574
MAMSTR MISSION shRNA Lentiviral Transduction Particles
MEF2 activating motif and SAP domain containing transcriptional regulator
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1206s21c1
Sequence:CCGGGAGGGCGCAGTTGCTTCCTAACTCGAGTTAGGAAGCAACTGCGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1484s21c1
Sequence:CCGGGCATCTTCTCCGCTGACTTATCTCGAGATAAGTCAGCGGAGAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182574.2-1549s21c1
Sequence:CCGGTGGTGATGGATTCTAGGATTTCTCGAGAAATCCTAGAATCCATCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-798s1c1
Sequence:CCGGGTTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-802s1c1
Sequence:CCGGGAACTTCAGACCCTTAAACTGCTCGAGCAGTTTAAGGGTCTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-789s1c1
Sequence:CCGGCCCACACAAGTTGGAACTTCACTCGAGTGAAGTTCCAACTTGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-1337s1c1
Sequence:CCGGCTGAAGGCCTCTCATCTGTTTCTCGAGAAACAGATGAGAGGCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182574.1-795s1c1
Sequence:CCGGCAAGTTGGAACTTCAGACCCTCTCGAGAGGGTCTGAAGTTCCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001476117
MAMSTR MISSION shRNA Bacterial Glycerol Stock
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000241414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001476117.1-1473s21c1
Sequence:CCGGCCGCTGCTGCTGATATCTTATCTCGAGATAAGATATCAGCAGCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-186s21c1
Sequence:CCGGTTCGGATCCACAGACGGAATCCTCGAGGATTCCGTCTGTGGATCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-1122s21c1
Sequence:CCGGTGGACTTCCCTGGCTCATTTGCTCGAGCAAATGAGCCAGGGAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-361s21c1
Sequence:CCGGTCCCAAGAACTCCCAACATTGCTCGAGCAATGTTGGGAGTTCTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001476117
MAMSTR MISSION shRNA shRNA Plasmid DNA
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000241414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001476117.1-1473s21c1
Sequence:CCGGCCGCTGCTGCTGATATCTTATCTCGAGATAAGATATCAGCAGCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-186s21c1
Sequence:CCGGTTCGGATCCACAGACGGAATCCTCGAGGATTCCGTCTGTGGATCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-1122s21c1
Sequence:CCGGTGGACTTCCCTGGCTCATTTGCTCGAGCAAATGAGCCAGGGAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-361s21c1
Sequence:CCGGTCCCAAGAACTCCCAACATTGCTCGAGCAATGTTGGGAGTTCTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001476117
MAMSTR MISSION shRNA Lentiviral Transduction Particles
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000241414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001476117.1-1473s21c1
Sequence:CCGGCCGCTGCTGCTGATATCTTATCTCGAGATAAGATATCAGCAGCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-186s21c1
Sequence:CCGGTTCGGATCCACAGACGGAATCCTCGAGGATTCCGTCTGTGGATCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-1122s21c1
Sequence:CCGGTGGACTTCCCTGGCTCATTTGCTCGAGCAAATGAGCCAGGGAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476117.1-361s21c1
Sequence:CCGGTCCCAAGAACTCCCAACATTGCTCGAGCAATGTTGGGAGTTCTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172418
MAMSTR MISSION shRNA Bacterial Glycerol Stock
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-1997s1c1
Sequence:CCGGGATGTGAAACTTTGTGCTGTTCTCGAGAACAGCACAAAGTTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-2331s1c1
Sequence:CCGGGCCATTATACCCAGTTCTCATCTCGAGATGAGAACTGGGTATAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-724s1c1
Sequence:CCGGCTGGAACTTCAGACCCTTAAACTCGAGTTTAAGGGTCTGAAGTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-969s1c1
Sequence:CCGGGACAAATCGTAGGCTGAAGTTCTCGAGAACTTCAGCCTACGATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-735s1c1
Sequence:CCGGGACCCTTAAACTGGAAGAGCTCTCGAGAGCTCTTCCAGTTTAAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-723s1c1
Sequence:CCGGGCTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172418
MAMSTR MISSION shRNA shRNA Plasmid DNA
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-1997s1c1
Sequence:CCGGGATGTGAAACTTTGTGCTGTTCTCGAGAACAGCACAAAGTTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-2331s1c1
Sequence:CCGGGCCATTATACCCAGTTCTCATCTCGAGATGAGAACTGGGTATAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-724s1c1
Sequence:CCGGCTGGAACTTCAGACCCTTAAACTCGAGTTTAAGGGTCTGAAGTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-969s1c1
Sequence:CCGGGACAAATCGTAGGCTGAAGTTCTCGAGAACTTCAGCCTACGATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-735s1c1
Sequence:CCGGGACCCTTAAACTGGAAGAGCTCTCGAGAGCTCTTCCAGTTTAAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-723s1c1
Sequence:CCGGGCTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172418
MAMSTR MISSION shRNA Lentiviral Transduction Particles
MEF2 activating motif and SAP domain containing transcriptional regulator
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-1997s1c1
Sequence:CCGGGATGTGAAACTTTGTGCTGTTCTCGAGAACAGCACAAAGTTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172418.1-2331s1c1
Sequence:CCGGGCCATTATACCCAGTTCTCATCTCGAGATGAGAACTGGGTATAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-724s1c1
Sequence:CCGGCTGGAACTTCAGACCCTTAAACTCGAGTTTAAGGGTCTGAAGTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-969s1c1
Sequence:CCGGGACAAATCGTAGGCTGAAGTTCTCGAGAACTTCAGCCTACGATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-735s1c1
Sequence:CCGGGACCCTTAAACTGGAAGAGCTCTCGAGAGCTCTTCCAGTTTAAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172418.1-723s1c1
Sequence:CCGGGCTGGAACTTCAGACCCTTAACTCGAGTTAAGGGTCTGAAGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)