EMAIL THIS PAGE TO A FRIEND

MAN1A1

mannosidase, alpha, class 1A, member 1

121 Gene Product Result for
Synonyms: HUMM3 HUMM9 MAN9
UniProtKB ID: P33908, Q9NU44, Q9UJI3
Gene ID:
Human(4121) Summary: This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Rat(294410) mannosidase, alpha, class 1A, member 1
sheep(101103326) mannosidase, alpha, class 1A, member 1
domestic guinea pig(100732532) mannosidase, alpha, class 1A, member 1
naked mole-rat(101714110) mannosidase, alpha, class 1A, member 1
Domestic Rabbit(100009182) mannosidase, alpha, class 1A, member 1
Zebrafish(566078) mannosidase, alpha, class 1A, member 1
Horse(100072869) mannosidase, alpha, class 1A, member 1
domestic cat(101100723) mannosidase, alpha, class 1A, member 1
dog(476275) mannosidase, alpha, class 1A, member 1
chicken(421726) mannosidase, alpha, class 1A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1140 Kifunensine mannosidase inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005907 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142671 MISSION® esiRNA esiRNA human MAN1A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005907 Rosetta Predictions human pricing
NM_001033656 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087290 predicted 2007
2 SASI_Hs01_00087291 predicted 2185
3 SASI_Hs01_00087292 predicted 1465
4 SASI_Hs01_00087293 predicted 1053
5 SASI_Hs01_00087294 predicted 1122
6 SASI_Hs01_00087295 predicted 1139
7 SASI_Hs01_00087296 predicted 1121
8 SASI_Hs01_00087297 predicted 2077
9 SASI_Hs01_00087299 predicted 1803
10 SASI_Hs02_00340520 predicted 1552
11 SASI_Hs01_00087298 predicted 2266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063520 predicted 1881
2 SASI_Rn01_00063521 predicted 2346
3 SASI_Rn01_00063522 predicted 2540
4 SASI_Rn01_00063523 predicted 1396
5 SASI_Rn01_00063524 predicted 2266
6 SASI_Rn01_00063525 predicted 2134
7 SASI_Rn02_00203657 predicted 2555
8 SASI_Rn01_00063526 predicted 2050
9 SASI_Rn01_00063527 predicted 2239
10 SASI_Rn01_00063528 predicted 1363
11 SASI_Rn01_00063529 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005907
VALIDATED
MAN1A1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1796s21c1
Sequence:CCGGTCTAGCAGCGGACTAACTTATCTCGAGATAAGTTAGTCCGCTGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2566s21c1
Sequence:CCGGGACCTAAATTCCTTATCATATCTCGAGATATGATAAGGAATTTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2436s21c1
Sequence:CCGGCCCTTCACTGTATACCTTAATCTCGAGATTAAGGTATACAGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1305s21c1
Sequence:CCGGGACTACTCTCAGCCTACTATCCTCGAGGATAGTAGGCTGAGAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1774s1c1
Sequence:CCGGCGAGACTCATTTGATCCGCAACTCGAGTTGCGGATCAAATGAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-2178s1c1
Sequence:CCGGGCAGAGTGAATGGAGGCTATTCTCGAGAATAGCCTCCATTCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-577s1c1
Sequence:CCGGGCTGGTATTCAGCGCCTTCATCTCGAGATGAAGGCGCTGAATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1143s1c1
Sequence:CCGGGTAACATCAAAGGAGCAACTACTCGAGTAGTTGCTCCTTTGATGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1606s1c1
Sequence:CCGGCCTTTATCCTAACTATCTGAACTCGAGTTCAGATAGTTAGGATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005907
VALIDATED
MAN1A1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1796s21c1
Sequence:CCGGTCTAGCAGCGGACTAACTTATCTCGAGATAAGTTAGTCCGCTGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2566s21c1
Sequence:CCGGGACCTAAATTCCTTATCATATCTCGAGATATGATAAGGAATTTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2436s21c1
Sequence:CCGGCCCTTCACTGTATACCTTAATCTCGAGATTAAGGTATACAGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1305s21c1
Sequence:CCGGGACTACTCTCAGCCTACTATCCTCGAGGATAGTAGGCTGAGAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1774s1c1
Sequence:CCGGCGAGACTCATTTGATCCGCAACTCGAGTTGCGGATCAAATGAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-2178s1c1
Sequence:CCGGGCAGAGTGAATGGAGGCTATTCTCGAGAATAGCCTCCATTCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-577s1c1
Sequence:CCGGGCTGGTATTCAGCGCCTTCATCTCGAGATGAAGGCGCTGAATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1143s1c1
Sequence:CCGGGTAACATCAAAGGAGCAACTACTCGAGTAGTTGCTCCTTTGATGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1606s1c1
Sequence:CCGGCCTTTATCCTAACTATCTGAACTCGAGTTCAGATAGTTAGGATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005907
VALIDATED
MAN1A1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1796s21c1
Sequence:CCGGTCTAGCAGCGGACTAACTTATCTCGAGATAAGTTAGTCCGCTGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2566s21c1
Sequence:CCGGGACCTAAATTCCTTATCATATCTCGAGATATGATAAGGAATTTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-2436s21c1
Sequence:CCGGCCCTTCACTGTATACCTTAATCTCGAGATTAAGGTATACAGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005907.2-1305s21c1
Sequence:CCGGGACTACTCTCAGCCTACTATCCTCGAGGATAGTAGGCTGAGAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1774s1c1
Sequence:CCGGCGAGACTCATTTGATCCGCAACTCGAGTTGCGGATCAAATGAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-2178s1c1
Sequence:CCGGGCAGAGTGAATGGAGGCTATTCTCGAGAATAGCCTCCATTCACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-577s1c1
Sequence:CCGGGCTGGTATTCAGCGCCTTCATCTCGAGATGAAGGCGCTGAATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1143s1c1
Sequence:CCGGGTAACATCAAAGGAGCAACTACTCGAGTAGTTGCTCCTTTGATGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005907.2-1606s1c1
Sequence:CCGGCCTTTATCCTAACTATCTGAACTCGAGTTCAGATAGTTAGGATAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)