EMAIL THIS PAGE TO A FRIEND

MAN1A2

mannosidase, alpha, class 1A, member 2

198 Gene Product Result for
Synonyms: MAN1B
UniProtKB ID: O60476, Q9H510
Gene ID:
Human(10905) Summary: Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
Mouse(17156) mannosidase, alpha, class 1A, member 2
Rat(295319) mannosidase, alpha, class 1A, member 2
chicken(418265) mannosidase, alpha, class 1A, member 2
cow(532645) mannosidase, alpha, class 1A, member 2
dog(483141) mannosidase, alpha, class 1A, member 2
Horse(100147103) mannosidase, alpha, class 1A, member 2
domestic cat(101086830) mannosidase, alpha, class 1A, member 2
Domestic Rabbit(100338665) mannosidase, alpha, class 1A, member 2
naked mole-rat(101700934) mannosidase, alpha, class 1A, member 2
domestic guinea pig(100723880) mannosidase, alpha, class 1A, member 2
sheep(101108177) mannosidase, alpha, class 1A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1140 Kifunensine mannosidase inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006699 Rosetta Predictions human pricing
NM_001106452 Rosetta Predictions rat pricing
NM_010763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109305 predicted 2589
2 SASI_Hs01_00109307 predicted 1930
3 SASI_Hs01_00109308 predicted 2141
4 SASI_Hs01_00109309 predicted 1415
5 SASI_Hs01_00109310 predicted 2329
6 SASI_Hs02_00342122 predicted 908
7 SASI_Hs01_00109312 predicted 1459
8 SASI_Hs01_00109314 predicted 2607
9 SASI_Hs02_00342123 predicted 1397
10 SASI_Hs02_00342124 predicted 1291
11 SASI_Hs01_00109306 predicted 2069
12 SASI_Hs01_00109311 predicted 2187
13 SASI_Hs01_00109313 predicted 2751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219098 predicted 1957
2 SASI_Rn02_00219099 predicted 1848
3 SASI_Rn02_00219100 predicted 1836
4 SASI_Rn02_00219101 predicted 561
5 SASI_Rn02_00219102 predicted 1468
6 SASI_Rn02_00219103 predicted 1776
7 SASI_Rn02_00219104 predicted 1967
8 SASI_Rn02_00219105 predicted 1105
9 SASI_Rn02_00219106 predicted 1038
10 SASI_Rn02_00219107 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035895 predicted 1835
2 SASI_Mm01_00035896 predicted 1988
3 SASI_Mm01_00035897 predicted 569
4 SASI_Mm01_00035898 predicted 1824
5 SASI_Mm01_00035900 predicted 1489
6 SASI_Mm01_00035901 predicted 2255
7 SASI_Mm01_00035902 predicted 1868
8 SASI_Mm02_00319297 predicted 1524
9 SASI_Mm01_00035903 predicted 1197
10 SASI_Mm01_00035904 predicted 2193
11 SASI_Mm01_00035899 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006699
VALIDATED
MAN1A2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1A, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1941s1c1
Sequence:CCGGGCATGGTTGATGTCAGATAAACTCGAGTTTATCTGACATCAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006699.2-2550s1c1
Sequence:CCGGCCTTTAGACCACTGGGTGTTTCTCGAGAAACACCCAGTGGTCTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1122s1c1
Sequence:CCGGGCAGAAATTCAGACAGAGAAACTCGAGTTTCTCTGTCTGAATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1396s1c1
Sequence:CCGGCCATAGTAGATGCTTTGGATACTCGAGTATCCAAAGCATCTACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-2148s1c1
Sequence:CCGGGCAGATAAAGCTGGTCATTATCTCGAGATAATGACCAGCTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1540s21c1
Sequence:CCGGAGGCCTACTTGCAGCATATTACTCGAGTAATATGCTGCAAGTAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1516s21c1
Sequence:CCGGTGAAGTCAACATTCGATTTATCTCGAGATAAATCGAATGTTGACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006699.3-3012s21c1
Sequence:CCGGTGGCCTTTGGAACCAATTATGCTCGAGCATAATTGGTTCCAAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006699
VALIDATED
MAN1A2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1A, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1941s1c1
Sequence:CCGGGCATGGTTGATGTCAGATAAACTCGAGTTTATCTGACATCAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006699.2-2550s1c1
Sequence:CCGGCCTTTAGACCACTGGGTGTTTCTCGAGAAACACCCAGTGGTCTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1122s1c1
Sequence:CCGGGCAGAAATTCAGACAGAGAAACTCGAGTTTCTCTGTCTGAATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1396s1c1
Sequence:CCGGCCATAGTAGATGCTTTGGATACTCGAGTATCCAAAGCATCTACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-2148s1c1
Sequence:CCGGGCAGATAAAGCTGGTCATTATCTCGAGATAATGACCAGCTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1540s21c1
Sequence:CCGGAGGCCTACTTGCAGCATATTACTCGAGTAATATGCTGCAAGTAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1516s21c1
Sequence:CCGGTGAAGTCAACATTCGATTTATCTCGAGATAAATCGAATGTTGACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006699.3-3012s21c1
Sequence:CCGGTGGCCTTTGGAACCAATTATGCTCGAGCATAATTGGTTCCAAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006699
VALIDATED
MAN1A2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1A, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1941s1c1
Sequence:CCGGGCATGGTTGATGTCAGATAAACTCGAGTTTATCTGACATCAACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_006699.2-2550s1c1
Sequence:CCGGCCTTTAGACCACTGGGTGTTTCTCGAGAAACACCCAGTGGTCTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1122s1c1
Sequence:CCGGGCAGAAATTCAGACAGAGAAACTCGAGTTTCTCTGTCTGAATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-1396s1c1
Sequence:CCGGCCATAGTAGATGCTTTGGATACTCGAGTATCCAAAGCATCTACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006699.2-2148s1c1
Sequence:CCGGGCAGATAAAGCTGGTCATTATCTCGAGATAATGACCAGCTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1540s21c1
Sequence:CCGGAGGCCTACTTGCAGCATATTACTCGAGTAATATGCTGCAAGTAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006699.3-1516s21c1
Sequence:CCGGTGAAGTCAACATTCGATTTATCTCGAGATAAATCGAATGTTGACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006699.3-3012s21c1
Sequence:CCGGTGGCCTTTGGAACCAATTATGCTCGAGCATAATTGGTTCCAAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010763
VALIDATED
MAN1A2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1A, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-3063s1c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1416s1c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1960s1c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-568s1c1
Sequence:CCGGCTGGGCTTAGAAGATGTGTTACTCGAGTAACACATCTTCTAAGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-938s1c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1661s21c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1183s21c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-2205s21c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010763.2-3308s21c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010763
VALIDATED
MAN1A2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1A, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-3063s1c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1416s1c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1960s1c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-568s1c1
Sequence:CCGGCTGGGCTTAGAAGATGTGTTACTCGAGTAACACATCTTCTAAGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-938s1c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1661s21c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1183s21c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-2205s21c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010763.2-3308s21c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010763
VALIDATED
MAN1A2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1A, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-3063s1c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1416s1c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-1960s1c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-568s1c1
Sequence:CCGGCTGGGCTTAGAAGATGTGTTACTCGAGTAACACATCTTCTAAGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010763.1-938s1c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1661s21c1
Sequence:CCGGCGGTGACTTGACTTACTATAACTCGAGTTATAGTAAGTCAAGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-1183s21c1
Sequence:CCGGCCTGGGATAATTACAGAACATCTCGAGATGTTCTGTAATTATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010763.2-2205s21c1
Sequence:CCGGCCAGAAGTAATTGAAACCTATCTCGAGATAGGTTTCAATTACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010763.2-3308s21c1
Sequence:CCGGGCCAGATTGTTGCCTTGAAATCTCGAGATTTCAAGGCAACAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)