EMAIL THIS PAGE TO A FRIEND

MAN1C1

mannosidase, alpha, class 1C, member 1

111 Gene Product Result for
Synonyms: HMIC MAN1A3 MAN1C pp6318
UniProtKB ID: Q9NR34, A6NNE2, B2RNP2, Q9Y545
Gene ID:
Mouse(230815) mannosidase, alpha, class 1C, member 1
Rat(362625) mannosidase, alpha, class 1C, member 1
chicken(419588) mannosidase, alpha, class 1C, member 1
dog(478178) mannosidase, alpha, class 1C, member 1
domestic cat(101099737) mannosidase, alpha, class 1C, member 1
cow(615012) mannosidase, alpha, class 1C, member 1
naked mole-rat(101699709) mannosidase, alpha, class 1C, member 1
Domestic Rabbit(100354369) mannosidase, alpha, class 1C, member 1
domestic guinea pig(100733888) mannosidase, alpha, class 1C, member 1
sheep(101118089) mannosidase, alpha, class 1C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1140 Kifunensine mannosidase inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020379 Rosetta Predictions human pricing
NM_001108687 Rosetta Predictions rat pricing
NM_207237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064009 predicted 1140
2 SASI_Hs01_00064010 predicted 888
3 SASI_Hs01_00064011 predicted 2086
4 SASI_Hs01_00064012 predicted 1148
5 SASI_Hs01_00064013 predicted 2276
6 SASI_Hs01_00064014 predicted 1538
7 SASI_Hs01_00064015 predicted 1089
8 SASI_Hs01_00064016 predicted 892
9 SASI_Hs01_00064017 predicted 979
10 SASI_Hs02_00353342 predicted 1089
11 SASI_Hs01_00064008 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241085 predicted 788
2 SASI_Rn02_00241086 predicted 836
3 SASI_Rn02_00241087 predicted 807
4 SASI_Rn02_00241088 predicted 1636
5 SASI_Rn02_00241089 predicted 1308
6 SASI_Rn02_00241090 predicted 1033
7 SASI_Rn02_00241091 predicted 406
8 SASI_Rn02_00241092 predicted 1010
9 SASI_Rn02_00241093 predicted 1744
10 SASI_Rn02_00241094 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142578 predicted 1179
2 SASI_Mm01_00142579 predicted 2030
3 SASI_Mm01_00142581 predicted 1399
4 SASI_Mm01_00142583 predicted 945
5 SASI_Mm02_00351961 predicted 939
6 SASI_Mm02_00351962 predicted 1132
7 SASI_Mm01_00142584 predicted 1220
8 SASI_Mm01_00142585 predicted 1202
9 SASI_Mm01_00142586 predicted 1904
10 SASI_Mm02_00351963 predicted 2087
11 SASI_Mm01_00142580 predicted 1699
12 SASI_Mm01_00142582 predicted 859
13 SASI_Mm01_00142587 predicted 2094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207237
MAN1C1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1C, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-794s1c1
Sequence:CCGGCGGTTCACTTTCGACTACAATCTCGAGATTGTAGTCGAAAGTGAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1028s1c1
Sequence:CCGGGCTACCATCATCGATTCTCTTCTCGAGAAGAGAATCGATGATGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-2132s1c1
Sequence:CCGGGAGACGCTGAAATACCTCTATCTCGAGATAGAGGTATTTCAGCGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-947s1c1
Sequence:CCGGCGTTATGCGATGGGCAAGAATCTCGAGATTCTTGCCCATCGCATAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1571s1c1
Sequence:CCGGTCCTGGTTGATGTCAGCCAAACTCGAGTTTGGCTGACATCAACCAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207237
MAN1C1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1C, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-794s1c1
Sequence:CCGGCGGTTCACTTTCGACTACAATCTCGAGATTGTAGTCGAAAGTGAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1028s1c1
Sequence:CCGGGCTACCATCATCGATTCTCTTCTCGAGAAGAGAATCGATGATGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-2132s1c1
Sequence:CCGGGAGACGCTGAAATACCTCTATCTCGAGATAGAGGTATTTCAGCGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-947s1c1
Sequence:CCGGCGTTATGCGATGGGCAAGAATCTCGAGATTCTTGCCCATCGCATAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1571s1c1
Sequence:CCGGTCCTGGTTGATGTCAGCCAAACTCGAGTTTGGCTGACATCAACCAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207237
MAN1C1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1C, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-794s1c1
Sequence:CCGGCGGTTCACTTTCGACTACAATCTCGAGATTGTAGTCGAAAGTGAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1028s1c1
Sequence:CCGGGCTACCATCATCGATTCTCTTCTCGAGAAGAGAATCGATGATGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-2132s1c1
Sequence:CCGGGAGACGCTGAAATACCTCTATCTCGAGATAGAGGTATTTCAGCGTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-947s1c1
Sequence:CCGGCGTTATGCGATGGGCAAGAATCTCGAGATTCTTGCCCATCGCATAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207237.1-1571s1c1
Sequence:CCGGTCCTGGTTGATGTCAGCCAAACTCGAGTTTGGCTGACATCAACCAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020379
MAN1C1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 1C, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-2086s1c1
Sequence:CCGGGAGACACTAAAGTATCTCTATCTCGAGATAGAGATACTTTAGTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-985s1c1
Sequence:CCGGACAGTCATTGACTCCCTCGATCTCGAGATCGAGGGAGTCAATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-384s1c1
Sequence:CCGGGCTGCCGCAGAAGTTCCTCTTCTCGAGAAGAGGAACTTCTGCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1798s1c1
Sequence:CCGGGCCCGCTCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGAGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1541s1c1
Sequence:CCGGGCAAGACAGATATGGAGGCTACTCGAGTAGCCTCCATATCTGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1085s21c1
Sequence:CCGGGCGGAGAAGCATCCTTGTTTGCTCGAGCAAACAAGGATGCTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1533s21c1
Sequence:CCGGGATGTCGGGCAAGACAGATATCTCGAGATATCTGTCTTGCCCGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-886s21c1
Sequence:CCGGTGGCAGAGCTATAAGCGTTATCTCGAGATAACGCTTATAGCTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1158s21c1
Sequence:CCGGAGAAGAGGTGTTCCGAATAAACTCGAGTTTATTCGGAACACCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020379
MAN1C1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 1C, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-2086s1c1
Sequence:CCGGGAGACACTAAAGTATCTCTATCTCGAGATAGAGATACTTTAGTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-985s1c1
Sequence:CCGGACAGTCATTGACTCCCTCGATCTCGAGATCGAGGGAGTCAATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-384s1c1
Sequence:CCGGGCTGCCGCAGAAGTTCCTCTTCTCGAGAAGAGGAACTTCTGCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1798s1c1
Sequence:CCGGGCCCGCTCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGAGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1541s1c1
Sequence:CCGGGCAAGACAGATATGGAGGCTACTCGAGTAGCCTCCATATCTGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1085s21c1
Sequence:CCGGGCGGAGAAGCATCCTTGTTTGCTCGAGCAAACAAGGATGCTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1533s21c1
Sequence:CCGGGATGTCGGGCAAGACAGATATCTCGAGATATCTGTCTTGCCCGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-886s21c1
Sequence:CCGGTGGCAGAGCTATAAGCGTTATCTCGAGATAACGCTTATAGCTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1158s21c1
Sequence:CCGGAGAAGAGGTGTTCCGAATAAACTCGAGTTTATTCGGAACACCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020379
MAN1C1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 1C, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-2086s1c1
Sequence:CCGGGAGACACTAAAGTATCTCTATCTCGAGATAGAGATACTTTAGTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-985s1c1
Sequence:CCGGACAGTCATTGACTCCCTCGATCTCGAGATCGAGGGAGTCAATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-384s1c1
Sequence:CCGGGCTGCCGCAGAAGTTCCTCTTCTCGAGAAGAGGAACTTCTGCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1798s1c1
Sequence:CCGGGCCCGCTCAGACACCAAACTTCTCGAGAAGTTTGGTGTCTGAGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020379.1-1541s1c1
Sequence:CCGGGCAAGACAGATATGGAGGCTACTCGAGTAGCCTCCATATCTGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1085s21c1
Sequence:CCGGGCGGAGAAGCATCCTTGTTTGCTCGAGCAAACAAGGATGCTTCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1533s21c1
Sequence:CCGGGATGTCGGGCAAGACAGATATCTCGAGATATCTGTCTTGCCCGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-886s21c1
Sequence:CCGGTGGCAGAGCTATAAGCGTTATCTCGAGATAACGCTTATAGCTCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020379.2-1158s21c1
Sequence:CCGGAGAAGAGGTGTTCCGAATAAACTCGAGTTTATTCGGAACACCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)