EMAIL THIS PAGE TO A FRIEND

MAN2A1

mannosidase, alpha, class 2A, member 1

121 Gene Product Result for
Synonyms: GOLIM7 MANA2 MANII
UniProtKB ID: Q16706, Q16767
Gene ID:
Human(4124) Summary: This gene encodes a protein which is a member of family 38 of the glycosyl hydrolases. The protein is located in the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
Mouse(17158) mannosidase 2, alpha 1
Rat(25478) mannosidase, alpha, class 2A, member 1
sheep(101116572) mannosidase, alpha, class 2A, member 1
domestic guinea pig(100722220) mannosidase, alpha, class 2A, member 1
Domestic Rabbit(100350334) mannosidase, alpha, class 2A, member 1
naked mole-rat(101697315) mannosidase, alpha, class 2A, member 1
Zebrafish(560219) mannosidase, alpha, class 2A, member 1
chicken(415611) mannosidase, alpha, class 2A, member 1
cow(521539) mannosidase, alpha, class 2A, member 1
domestic cat(101086451) mannosidase, alpha, class 2A, member 1
Horse(100064575) mannosidase, alpha, class 2A, member 1
dog(488878) mannosidase, alpha, class 2A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002372 Rosetta Predictions human pricing
NM_012979 Rosetta Predictions rat pricing
XM_001068826 Rosetta Predictions rat pricing
XM_001071911 Rosetta Predictions rat pricing
NM_008549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156080 predicted 3970
2 SASI_Hs01_00156082 predicted 3293
3 SASI_Hs02_00333707 predicted 2706
4 SASI_Hs02_00333708 predicted 3227
5 SASI_Hs01_00156083 predicted 1718
6 SASI_Hs01_00156084 predicted 4181
7 SASI_Hs01_00156085 predicted 3888
8 SASI_Hs01_00156087 predicted 3638
9 SASI_Hs02_00333709 predicted 3407
10 SASI_Hs01_00156089 predicted 3836
11 SASI_Hs01_00156081 predicted 2442
12 SASI_Hs01_00156086 predicted 1748
13 SASI_Hs01_00156088 predicted 4098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260582 predicted 2340
2 SASI_Rn02_00260583 predicted 1647
3 SASI_Rn02_00260584 predicted 2541
4 SASI_Rn02_00260585 predicted 3813
5 SASI_Rn02_00260586 predicted 2359
6 SASI_Rn02_00260587 predicted 2519
7 SASI_Rn02_00260588 predicted 2572
8 SASI_Rn02_00260589 predicted 1542
9 SASI_Rn02_00260590 predicted 3654
10 SASI_Rn02_00260591 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326017 predicted 2345
2 SASI_Rn02_00326018 predicted 2542
3 SASI_Rn02_00326019 predicted 2362
4 SASI_Rn02_00326020 predicted 3265
5 SASI_Rn02_00326021 predicted 3177
6 SASI_Rn02_00326022 predicted 2516
7 SASI_Rn02_00326023 predicted 2572
8 SASI_Rn02_00326024 predicted 2622
9 SASI_Rn02_00326025 predicted 3204
10 SASI_Rn02_00326026 predicted 3138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336974 predicted 2344
2 SASI_Rn02_00336975 predicted 1648
3 SASI_Rn02_00336976 predicted 2548
4 SASI_Rn02_00336977 predicted 3813
5 SASI_Rn02_00336978 predicted 2362
6 SASI_Rn02_00336979 predicted 2516
7 SASI_Rn02_00336980 predicted 2573
8 SASI_Rn02_00336981 predicted 1542
9 SASI_Rn02_00336982 predicted 3652
10 SASI_Rn02_00336983 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030530 predicted 859
2 SASI_Mm01_00030531 predicted 2269
3 SASI_Mm01_00030532 predicted 3016
4 SASI_Mm01_00030533 predicted 2381
5 SASI_Mm01_00030534 predicted 696
6 SASI_Mm01_00030535 predicted 644
7 SASI_Mm01_00030536 predicted 538
8 SASI_Mm01_00030537 predicted 3223
9 SASI_Mm01_00030538 predicted 1628
10 SASI_Mm01_00030539 predicted 2698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002372
VALIDATED
MAN2A1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2A, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-2451s21c1
Sequence:CCGGTGCCGATCGAGATGATCATTACTCGAGTAATGATCATCTCGATCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4689s21c1
Sequence:CCGGAGATTGTATCTCAGGTTAAATCTCGAGATTTAACCTGAGATACAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-1508s21c1
Sequence:CCGGAGACTTTCAATGACTACTTTACTCGAGTAAAGTAGTCATTGAAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4444s21c1
Sequence:CCGGTTCTTGGTTTGACGTGCAATACTCGAGTATTGCACGTCAAACCAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4639s21c1
Sequence:CCGGGTATGAATTGATGCAACAAATCTCGAGATTTGTTGCATCAATTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-2114s1c1
Sequence:CCGGCCCTGAGACAAGCTCACAAATCTCGAGATTTGTGAGCTTGTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-3528s1c1
Sequence:CCGGCCACATAACTTCTTCTCTCATCTCGAGATGAGAGAAGAAGTTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-957s1c1
Sequence:CCGGGCAAGGATTTGACATTACTTACTCGAGTAAGTAATGTCAAATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-1793s1c1
Sequence:CCGGGCTACTGTGAATACACGGAATCTCGAGATTCCGTGTATTCACAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002372.1-2929s1c1
Sequence:CCGGGCCTACCTCTTCTTACCTGATCTCGAGATCAGGTAAGAAGAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002372
VALIDATED
MAN2A1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2A, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-2451s21c1
Sequence:CCGGTGCCGATCGAGATGATCATTACTCGAGTAATGATCATCTCGATCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4689s21c1
Sequence:CCGGAGATTGTATCTCAGGTTAAATCTCGAGATTTAACCTGAGATACAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-1508s21c1
Sequence:CCGGAGACTTTCAATGACTACTTTACTCGAGTAAAGTAGTCATTGAAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4444s21c1
Sequence:CCGGTTCTTGGTTTGACGTGCAATACTCGAGTATTGCACGTCAAACCAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4639s21c1
Sequence:CCGGGTATGAATTGATGCAACAAATCTCGAGATTTGTTGCATCAATTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-2114s1c1
Sequence:CCGGCCCTGAGACAAGCTCACAAATCTCGAGATTTGTGAGCTTGTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-3528s1c1
Sequence:CCGGCCACATAACTTCTTCTCTCATCTCGAGATGAGAGAAGAAGTTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-957s1c1
Sequence:CCGGGCAAGGATTTGACATTACTTACTCGAGTAAGTAATGTCAAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-1793s1c1
Sequence:CCGGGCTACTGTGAATACACGGAATCTCGAGATTCCGTGTATTCACAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002372.1-2929s1c1
Sequence:CCGGGCCTACCTCTTCTTACCTGATCTCGAGATCAGGTAAGAAGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002372
VALIDATED
MAN2A1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2A, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-2451s21c1
Sequence:CCGGTGCCGATCGAGATGATCATTACTCGAGTAATGATCATCTCGATCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4689s21c1
Sequence:CCGGAGATTGTATCTCAGGTTAAATCTCGAGATTTAACCTGAGATACAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002372.2-1508s21c1
Sequence:CCGGAGACTTTCAATGACTACTTTACTCGAGTAAAGTAGTCATTGAAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4444s21c1
Sequence:CCGGTTCTTGGTTTGACGTGCAATACTCGAGTATTGCACGTCAAACCAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002372.2-4639s21c1
Sequence:CCGGGTATGAATTGATGCAACAAATCTCGAGATTTGTTGCATCAATTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-2114s1c1
Sequence:CCGGCCCTGAGACAAGCTCACAAATCTCGAGATTTGTGAGCTTGTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-3528s1c1
Sequence:CCGGCCACATAACTTCTTCTCTCATCTCGAGATGAGAGAAGAAGTTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-957s1c1
Sequence:CCGGGCAAGGATTTGACATTACTTACTCGAGTAAGTAATGTCAAATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002372.1-1793s1c1
Sequence:CCGGGCTACTGTGAATACACGGAATCTCGAGATTCCGTGTATTCACAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002372.1-2929s1c1
Sequence:CCGGGCCTACCTCTTCTTACCTGATCTCGAGATCAGGTAAGAAGAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008549
VALIDATED
MAN2A1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2A, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-3252s21c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1687s21c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-273s21c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-868s21c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1964s21c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-1687s1c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-3252s1c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-1964s1c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-273s1c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-868s1c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008549
VALIDATED
MAN2A1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2A, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-3252s21c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1687s21c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-273s21c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-868s21c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1964s21c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-1687s1c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-3252s1c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-1964s1c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-273s1c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-868s1c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008549
VALIDATED
MAN2A1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2A, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-3252s21c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1687s21c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-273s21c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008549.1-868s21c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008549.1-1964s21c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-1687s1c1
Sequence:CCGGGCCTTGAAACAAGCTCAGAAACTCGAGTTTCTGAGCTTGTTTCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-3252s1c1
Sequence:CCGGGCGGACAATACAATCAAAGATCTCGAGATCTTTGATTGTATTGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-1964s1c1
Sequence:CCGGCGAAGCAAAGTTCACAAGATTCTCGAGAATCTTGTGAACTTTGCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008549.1-273s1c1
Sequence:CCGGCGCTGAGAACAACGAGATCATCTCGAGATGATCTCGTTGTTCTCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008549.1-868s1c1
Sequence:CCGGGCCTTAATTGACCAACTAATTCTCGAGAATTAGTTGGTCAATTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)