EMAIL THIS PAGE TO A FRIEND

MAN2A2

mannosidase, alpha, class 2A, member 2

193 Gene Product Result for
Synonyms: MANA2X
UniProtKB ID: P49641, A6NH12, A8K1E8, Q13754
Gene ID:
Mouse(140481) mannosidase 2, alpha 2
Rat(308757) mannosidase, alpha, class 2A, member 2
Zebrafish(100333987) mannosidase, alpha, class 2A, member 2
cow(527449) mannosidase, alpha, class 2A, member 2
domestic cat(101101317) mannosidase, alpha, class 2A, member 2
dog(488745) mannosidase, alpha, class 2A, member 2
chicken(415585) mannosidase, alpha, class 2A, member 2
naked mole-rat(101717094) mannosidase, alpha, class 2A, member 2
Domestic Rabbit(100345634) mannosidase, alpha, class 2A, member 2
domestic guinea pig(100734282) mannosidase, alpha, class 2A, member 2
sheep(101106798) mannosidase, alpha, class 2A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006122 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160411 MISSION® esiRNA esiRNA targeting mouse Man2a2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006122 Rosetta Predictions human pricing
NM_001107527 Rosetta Predictions rat pricing
NM_172903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046078 predicted 1286
2 SASI_Hs01_00046079 predicted 2800
3 SASI_Hs02_00340949 predicted 1042
4 SASI_Hs01_00046080 predicted 3238
5 SASI_Hs01_00046082 predicted 2809
6 SASI_Hs01_00046083 predicted 2320
7 SASI_Hs01_00046084 predicted 1153
8 SASI_Hs01_00046085 predicted 209
9 SASI_Hs01_00046086 predicted 601
10 SASI_Hs01_00046087 predicted 1993
11 SASI_Hs01_00046081 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229705 predicted 1062
2 SASI_Rn02_00229706 predicted 2082
3 SASI_Rn02_00229707 predicted 997
4 SASI_Rn02_00229708 predicted 2923
5 SASI_Rn02_00229709 predicted 1934
6 SASI_Rn02_00229710 predicted 491
7 SASI_Rn02_00229711 predicted 2241
8 SASI_Rn02_00229712 predicted 438
9 SASI_Rn02_00229713 predicted 2170
10 SASI_Rn02_00229714 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194799 predicted 1898
2 SASI_Mm02_00344890 predicted 3684
3 SASI_Mm01_00194800 predicted 3172
4 SASI_Mm01_00194801 predicted 1922
5 SASI_Mm01_00194802 predicted 3730
6 SASI_Mm01_00194803 predicted 2274
7 SASI_Mm01_00194806 predicted 2153
8 SASI_Mm01_00194807 predicted 2364
9 SASI_Mm01_00194808 predicted 1424
10 SASI_Mm02_00344891 predicted 3720
11 SASI_Mm01_00194804 predicted 3785
12 SASI_Mm01_00194805 predicted 2625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172903
VALIDATED
MAN2A2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2734s1c1
Sequence:CCGGCCACTACTGGACAGGCTATTACTCGAGTAATAGCCTGTCCAGTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1423s1c1
Sequence:CCGGCCATGACATCATAAGCCGTATCTCGAGATACGGCTTATGATGTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2158s1c1
Sequence:CCGGGCTGATTCAGAGGGTGCATTACTCGAGTAATGCACCCTCTGAATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1608s1c1
Sequence:CCGGAGCCAGAACTACAGATGTTAACTCGAGTTAACATCTGTAGTTCTGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-3182s1c1
Sequence:CCGGGTGGTATTTAACCCGCTGGAACTCGAGTTCCAGCGGGTTAAATACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172903
VALIDATED
MAN2A2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2734s1c1
Sequence:CCGGCCACTACTGGACAGGCTATTACTCGAGTAATAGCCTGTCCAGTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1423s1c1
Sequence:CCGGCCATGACATCATAAGCCGTATCTCGAGATACGGCTTATGATGTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2158s1c1
Sequence:CCGGGCTGATTCAGAGGGTGCATTACTCGAGTAATGCACCCTCTGAATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1608s1c1
Sequence:CCGGAGCCAGAACTACAGATGTTAACTCGAGTTAACATCTGTAGTTCTGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-3182s1c1
Sequence:CCGGGTGGTATTTAACCCGCTGGAACTCGAGTTCCAGCGGGTTAAATACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172903
VALIDATED
MAN2A2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2734s1c1
Sequence:CCGGCCACTACTGGACAGGCTATTACTCGAGTAATAGCCTGTCCAGTAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1423s1c1
Sequence:CCGGCCATGACATCATAAGCCGTATCTCGAGATACGGCTTATGATGTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-2158s1c1
Sequence:CCGGGCTGATTCAGAGGGTGCATTACTCGAGTAATGCACCCTCTGAATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-1608s1c1
Sequence:CCGGAGCCAGAACTACAGATGTTAACTCGAGTTAACATCTGTAGTTCTGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172903.1-3182s1c1
Sequence:CCGGGTGGTATTTAACCCGCTGGAACTCGAGTTCCAGCGGGTTAAATACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006122
MAN2A2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2A, member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1814s21c1
Sequence:CCGGTCATTCATGCAGCCCACTATCCTCGAGGATAGTGGGCTGCATGAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-2405s21c1
Sequence:CCGGACATGCAGGTCCTTGTCTATGCTCGAGCATAGACAAGGACCTGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-653s1c1
Sequence:CCGGCCTCAATAGCATGGTGTCTAACTCGAGTTAGACACCATGCTATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-995s1c1
Sequence:CCGGGCTGATTCAGAGAGTGCACTACTCGAGTAGTGCACTCTCTGAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-2005s1c1
Sequence:CCGGCGCCCAGGTTTGTGGTCCTATCTCGAGATAGGACCACAAACCTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-260s1c1
Sequence:CCGGCCATGAGATTATCAGCCATATCTCGAGATATGGCTGATAATCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-1377s1c1
Sequence:CCGGGCCCAGTTCTTCAACTACCAACTCGAGTTGGTAGTTGAAGAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1522s21c1
Sequence:CCGGCATTACTGGACAGGCTATTACCTCGAGGTAATAGCCTGTCCAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3784s21c1
Sequence:CCGGTTTCCAAACAGGGATATAGAACTCGAGTTCTATATCCCTGTTTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3533s21c1
Sequence:CCGGTTGGACAAGCCACACGGGTATCTCGAGATACCCGTGTGGCTTGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3507s21c1
Sequence:CCGGGAGACTGCCTCTTAACATGAACTCGAGTTCATGTTAAGAGGCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-3407s21c1
Sequence:CCGGCCAACAGCACTGACGTCTATTCTCGAGAATAGACGTCAGTGCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006122
MAN2A2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2A, member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1814s21c1
Sequence:CCGGTCATTCATGCAGCCCACTATCCTCGAGGATAGTGGGCTGCATGAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-2405s21c1
Sequence:CCGGACATGCAGGTCCTTGTCTATGCTCGAGCATAGACAAGGACCTGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-653s1c1
Sequence:CCGGCCTCAATAGCATGGTGTCTAACTCGAGTTAGACACCATGCTATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-995s1c1
Sequence:CCGGGCTGATTCAGAGAGTGCACTACTCGAGTAGTGCACTCTCTGAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-2005s1c1
Sequence:CCGGCGCCCAGGTTTGTGGTCCTATCTCGAGATAGGACCACAAACCTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-260s1c1
Sequence:CCGGCCATGAGATTATCAGCCATATCTCGAGATATGGCTGATAATCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-1377s1c1
Sequence:CCGGGCCCAGTTCTTCAACTACCAACTCGAGTTGGTAGTTGAAGAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1522s21c1
Sequence:CCGGCATTACTGGACAGGCTATTACCTCGAGGTAATAGCCTGTCCAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3784s21c1
Sequence:CCGGTTTCCAAACAGGGATATAGAACTCGAGTTCTATATCCCTGTTTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3533s21c1
Sequence:CCGGTTGGACAAGCCACACGGGTATCTCGAGATACCCGTGTGGCTTGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3507s21c1
Sequence:CCGGGAGACTGCCTCTTAACATGAACTCGAGTTCATGTTAAGAGGCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-3407s21c1
Sequence:CCGGCCAACAGCACTGACGTCTATTCTCGAGAATAGACGTCAGTGCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006122
MAN2A2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2A, member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1814s21c1
Sequence:CCGGTCATTCATGCAGCCCACTATCCTCGAGGATAGTGGGCTGCATGAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-2405s21c1
Sequence:CCGGACATGCAGGTCCTTGTCTATGCTCGAGCATAGACAAGGACCTGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-653s1c1
Sequence:CCGGCCTCAATAGCATGGTGTCTAACTCGAGTTAGACACCATGCTATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-995s1c1
Sequence:CCGGGCTGATTCAGAGAGTGCACTACTCGAGTAGTGCACTCTCTGAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-2005s1c1
Sequence:CCGGCGCCCAGGTTTGTGGTCCTATCTCGAGATAGGACCACAAACCTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-260s1c1
Sequence:CCGGCCATGAGATTATCAGCCATATCTCGAGATATGGCTGATAATCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006122.1-1377s1c1
Sequence:CCGGGCCCAGTTCTTCAACTACCAACTCGAGTTGGTAGTTGAAGAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-1522s21c1
Sequence:CCGGCATTACTGGACAGGCTATTACCTCGAGGTAATAGCCTGTCCAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3784s21c1
Sequence:CCGGTTTCCAAACAGGGATATAGAACTCGAGTTCTATATCCCTGTTTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3533s21c1
Sequence:CCGGTTGGACAAGCCACACGGGTATCTCGAGATACCCGTGTGGCTTGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006122.2-3507s21c1
Sequence:CCGGGAGACTGCCTCTTAACATGAACTCGAGTTCATGTTAAGAGGCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006122.2-3407s21c1
Sequence:CCGGCCAACAGCACTGACGTCTATTCTCGAGAATAGACGTCAGTGCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)