EMAIL THIS PAGE TO A FRIEND

MAN2B1

mannosidase, alpha, class 2B, member 1

51 Gene Product Result for
Synonyms: LAMAN MANB
UniProtKB ID: O00754, G5E928, O15330, Q16680, Q93094, Q9BW13
Gene ID:
Human(4125) Summary: This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Mouse(17159) mannosidase 2, alpha B1
Rat(361378) mannosidase, alpha, class 2B, member 1
sheep(101102146) mannosidase, alpha, class 2B, member 1
domestic guinea pig(100718205) mannosidase 2, alpha B1
naked mole-rat(101705792) mannosidase, alpha, class 2B, member 1
Zebrafish(541519) mannosidase, alpha, class 2B, member 1
dog(484932) mannosidase, alpha, class 2B, member 1
cow(282272) mannosidase, alpha, class 2B, member 1
domestic cat(493697) mannosidase, alpha, class 2B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000528 Rosetta Predictions human pricing
NM_199404 Rosetta Predictions rat pricing
NM_010764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235456 predicted 2403
2 SASI_Hs01_00235457 predicted 245
3 SASI_Hs01_00235458 predicted 980
4 SASI_Hs01_00235459 predicted 2008
5 SASI_Hs02_00302737 predicted 1288
6 SASI_Hs01_00235461 predicted 2417
7 SASI_Hs01_00235462 predicted 2100
8 SASI_Hs01_00235463 predicted 2538
9 SASI_Hs01_00235464 predicted 2281
10 SASI_Hs01_00235465 predicted 1050
11 SASI_Hs01_00235460 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107995 predicted 1878
2 SASI_Rn01_00107996 predicted 2353
3 SASI_Rn01_00107997 predicted 888
4 SASI_Rn01_00107998 predicted 637
5 SASI_Rn01_00107999 predicted 1110
6 SASI_Rn01_00108000 predicted 332
7 SASI_Rn01_00108001 predicted 1133
8 SASI_Rn01_00108002 predicted 2201
9 SASI_Rn01_00108003 predicted 1683
10 SASI_Rn02_00270231 predicted 232
11 SASI_Rn01_00108004 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094854 predicted 676
2 SASI_Mm01_00094855 predicted 2050
3 SASI_Mm01_00094856 predicted 1865
4 SASI_Mm01_00094857 predicted 2688
5 SASI_Mm01_00094858 predicted 2864
6 SASI_Mm02_00319298 predicted 1210
7 SASI_Mm01_00094861 predicted 2091
8 SASI_Mm02_00319299 predicted 320
9 SASI_Mm02_00319300 predicted 600
10 SASI_Mm01_00094862 predicted 2512
11 SASI_Mm01_00094853 predicted 660
12 SASI_Mm01_00094859 predicted 1616
13 SASI_Mm01_00094860 predicted 2552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000528
MAN2B1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2B, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000528.3-1077s21c1
Sequence:CCGGAGCTCATCCGGCTGGTAAATGCTCGAGCATTTACCAGCCGGATGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-649s1c1
Sequence:CCGGCGCTTCATTTACGTGGAGATTCTCGAGAATCTCCACGTAAATGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2649s1c1
Sequence:CCGGGATTTACATCACGGATGGAAACTCGAGTTTCCATCCGTGATGTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2243s1c1
Sequence:CCGGCCAGTATAGGTGACAACGAAACTCGAGTTTCGTTGTCACCTATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1266s1c1
Sequence:CCGGCCAATATGAGAATGCCAACATCTCGAGATGTTGGCATTCTCATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1831s1c1
Sequence:CCGGCGCTTCCAGGTCATCGTTTATCTCGAGATAAACGATGACCTGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000528
MAN2B1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2B, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000528.3-1077s21c1
Sequence:CCGGAGCTCATCCGGCTGGTAAATGCTCGAGCATTTACCAGCCGGATGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-649s1c1
Sequence:CCGGCGCTTCATTTACGTGGAGATTCTCGAGAATCTCCACGTAAATGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2649s1c1
Sequence:CCGGGATTTACATCACGGATGGAAACTCGAGTTTCCATCCGTGATGTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2243s1c1
Sequence:CCGGCCAGTATAGGTGACAACGAAACTCGAGTTTCGTTGTCACCTATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1266s1c1
Sequence:CCGGCCAATATGAGAATGCCAACATCTCGAGATGTTGGCATTCTCATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1831s1c1
Sequence:CCGGCGCTTCCAGGTCATCGTTTATCTCGAGATAAACGATGACCTGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000528
MAN2B1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2B, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000528.3-1077s21c1
Sequence:CCGGAGCTCATCCGGCTGGTAAATGCTCGAGCATTTACCAGCCGGATGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-649s1c1
Sequence:CCGGCGCTTCATTTACGTGGAGATTCTCGAGAATCTCCACGTAAATGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2649s1c1
Sequence:CCGGGATTTACATCACGGATGGAAACTCGAGTTTCCATCCGTGATGTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-2243s1c1
Sequence:CCGGCCAGTATAGGTGACAACGAAACTCGAGTTTCGTTGTCACCTATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1266s1c1
Sequence:CCGGCCAATATGAGAATGCCAACATCTCGAGATGTTGGCATTCTCATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000528.1-1831s1c1
Sequence:CCGGCGCTTCCAGGTCATCGTTTATCTCGAGATAAACGATGACCTGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010764
VALIDATED
MAN2B1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2B, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-2828s21c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-1418s21c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-719s21c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-401s21c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010764.1-1975s1c1
Sequence:CCGGGCCTACATCTTCAGACCCAATCTCGAGATTGGGTCTGAAGATGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-1354s1c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-655s1c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-337s1c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-2764s1c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010764
VALIDATED
MAN2B1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2B, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-2828s21c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-1418s21c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-719s21c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-401s21c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010764.1-1975s1c1
Sequence:CCGGGCCTACATCTTCAGACCCAATCTCGAGATTGGGTCTGAAGATGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-1354s1c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-655s1c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-337s1c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-2764s1c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010764
VALIDATED
MAN2B1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2B, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-2828s21c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-1418s21c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-719s21c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010764.2-401s21c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010764.1-1975s1c1
Sequence:CCGGGCCTACATCTTCAGACCCAATCTCGAGATTGGGTCTGAAGATGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-1354s1c1
Sequence:CCGGGCAAGGCAGAATGTTGTAAATCTCGAGATTTACAACATTCTGCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-655s1c1
Sequence:CCGGCGCATTGACTATCAAGATAAACTCGAGTTTATCTTGATAGTCAATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-337s1c1
Sequence:CCGGCGTCGCTTCATCTATGTGGAACTCGAGTTCCACATAGATGAAGCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010764.1-2764s1c1
Sequence:CCGGGCTCTGAAAGAAGATTCGGATCTCGAGATCCGAATCTTCTTTCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)