EMAIL THIS PAGE TO A FRIEND

MAN2B2

mannosidase, alpha, class 2B, member 2

106 Gene Product Result for
UniProtKB ID: Q9Y2E5, Q66MP2, Q86T67
Gene ID:
Mouse(17160) mannosidase 2, alpha B2
Rat(360955) mannosidase, alpha, class 2B, member 2
Zebrafish(100003570) mannosidase, alpha, class 2B, member 2
cow(523503) mannosidase, alpha, class 2B, member 2
cow(781835) mannosidase, alpha, class 2B, member 2
domestic cat(101091532) mannosidase, alpha, class 2B, member 2
dog(488779) mannosidase, alpha, class 2B, member 2
chicken(422859) mannosidase, alpha, class 2B, member 2
naked mole-rat(101712594) mannosidase, alpha, class 2B, member 2
domestic guinea pig(100714714) mannosidase, alpha, class 2B, member 2
sheep(101112483) mannosidase, alpha, class 2B, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015274 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015274 Rosetta Predictions human pricing
NM_008550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066007 predicted 1610
2 SASI_Hs02_00347433 predicted 2315
3 SASI_Hs01_00066008 predicted 639
4 SASI_Hs01_00066009 predicted 1795
5 SASI_Hs01_00066010 predicted 1598
6 SASI_Hs02_00347434 predicted 1630
7 SASI_Hs01_00066011 predicted 2016
8 SASI_Hs01_00066012 predicted 2445
9 SASI_Hs01_00066013 predicted 1992
10 SASI_Hs01_00066016 predicted 886
11 SASI_Hs01_00066014 predicted 447
12 SASI_Hs01_00066015 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107731 predicted 1829
2 SASI_Mm01_00107732 predicted 1847
3 SASI_Mm01_00107733 predicted 2079
4 SASI_Mm01_00107734 predicted 2069
5 SASI_Mm01_00107735 predicted 2666
6 SASI_Mm01_00107736 predicted 603
7 SASI_Mm01_00107737 predicted 1689
8 SASI_Mm01_00107738 predicted 1868
9 SASI_Mm01_00107739 predicted 906
10 SASI_Mm01_00107740 predicted 1650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015274
MAN2B2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2B, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015274.1-3930s1c1
Sequence:CCGGCCTGAGTGAATCCTACAAATACTCGAGTATTTGTAGGATTCACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-2259s1c1
Sequence:CCGGGCCCTACGTTTCCTATGTGAACTCGAGTTCACATAGGAAACGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-645s1c1
Sequence:CCGGGCAGGAAATCTTCACGCACATCTCGAGATGTGCGTGAAGATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-802s1c1
Sequence:CCGGCCAGCCAACATCAACCTCTATCTCGAGATAGAGGTTGATGTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-3034s1c1
Sequence:CCGGCGGACGTTCTTTATTCACTTTCTCGAGAAAGTGAATAAAGAACGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1712s21c1
Sequence:CCGGTGGCGAGCACCCTTCAATTTGCTCGAGCAAATTGAAGGGTGCTCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1601s21c1
Sequence:CCGGCTGCGTATGACCTGCTTATTCCTCGAGGAATAAGCAGGTCATACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015274.1-3193s21c1
Sequence:CCGGTGGCAGGAAATGGTCATATTTCTCGAGAAATATGACCATTTCCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015274
MAN2B2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2B, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015274.1-3930s1c1
Sequence:CCGGCCTGAGTGAATCCTACAAATACTCGAGTATTTGTAGGATTCACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-2259s1c1
Sequence:CCGGGCCCTACGTTTCCTATGTGAACTCGAGTTCACATAGGAAACGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-645s1c1
Sequence:CCGGGCAGGAAATCTTCACGCACATCTCGAGATGTGCGTGAAGATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-802s1c1
Sequence:CCGGCCAGCCAACATCAACCTCTATCTCGAGATAGAGGTTGATGTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-3034s1c1
Sequence:CCGGCGGACGTTCTTTATTCACTTTCTCGAGAAAGTGAATAAAGAACGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1712s21c1
Sequence:CCGGTGGCGAGCACCCTTCAATTTGCTCGAGCAAATTGAAGGGTGCTCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1601s21c1
Sequence:CCGGCTGCGTATGACCTGCTTATTCCTCGAGGAATAAGCAGGTCATACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015274.1-3193s21c1
Sequence:CCGGTGGCAGGAAATGGTCATATTTCTCGAGAAATATGACCATTTCCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015274
MAN2B2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2B, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015274.1-3930s1c1
Sequence:CCGGCCTGAGTGAATCCTACAAATACTCGAGTATTTGTAGGATTCACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-2259s1c1
Sequence:CCGGGCCCTACGTTTCCTATGTGAACTCGAGTTCACATAGGAAACGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-645s1c1
Sequence:CCGGGCAGGAAATCTTCACGCACATCTCGAGATGTGCGTGAAGATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-802s1c1
Sequence:CCGGCCAGCCAACATCAACCTCTATCTCGAGATAGAGGTTGATGTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015274.1-3034s1c1
Sequence:CCGGCGGACGTTCTTTATTCACTTTCTCGAGAAAGTGAATAAAGAACGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1712s21c1
Sequence:CCGGTGGCGAGCACCCTTCAATTTGCTCGAGCAAATTGAAGGGTGCTCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015274.1-1601s21c1
Sequence:CCGGCTGCGTATGACCTGCTTATTCCTCGAGGAATAAGCAGGTCATACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015274.1-3193s21c1
Sequence:CCGGTGGCAGGAAATGGTCATATTTCTCGAGAAATATGACCATTTCCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008550
VALIDATED
MAN2B2 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2B, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-1832s1c1
Sequence:CCGGCCCGTGATGAATGACTGCTATCTCGAGATAGCAGTCATTCATCACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008550.1-2080s1c1
Sequence:CCGGGCAGTATTTCTACAGGTACATCTCGAGATGTACCTGTAGAAATACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-2058s1c1
Sequence:CCGGGCACACTGGTAACGGACATAACTCGAGTTATGTCCGTTACCAGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-3079s1c1
Sequence:CCGGCCGGACCTTCTTCATTAAATTCTCGAGAATTTAATGAAGAAGGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-560s1c1
Sequence:CCGGGCCCATCTCATCTCTCGTATTCTCGAGAATACGAGAGATGAGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008550
VALIDATED
MAN2B2 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2B, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-1832s1c1
Sequence:CCGGCCCGTGATGAATGACTGCTATCTCGAGATAGCAGTCATTCATCACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008550.1-2080s1c1
Sequence:CCGGGCAGTATTTCTACAGGTACATCTCGAGATGTACCTGTAGAAATACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-2058s1c1
Sequence:CCGGGCACACTGGTAACGGACATAACTCGAGTTATGTCCGTTACCAGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-3079s1c1
Sequence:CCGGCCGGACCTTCTTCATTAAATTCTCGAGAATTTAATGAAGAAGGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-560s1c1
Sequence:CCGGGCCCATCTCATCTCTCGTATTCTCGAGAATACGAGAGATGAGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008550
VALIDATED
MAN2B2 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2B, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-1832s1c1
Sequence:CCGGCCCGTGATGAATGACTGCTATCTCGAGATAGCAGTCATTCATCACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008550.1-2080s1c1
Sequence:CCGGGCAGTATTTCTACAGGTACATCTCGAGATGTACCTGTAGAAATACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-2058s1c1
Sequence:CCGGGCACACTGGTAACGGACATAACTCGAGTTATGTCCGTTACCAGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-3079s1c1
Sequence:CCGGCCGGACCTTCTTCATTAAATTCTCGAGAATTTAATGAAGAAGGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008550.1-560s1c1
Sequence:CCGGGCCCATCTCATCTCTCGTATTCTCGAGAATACGAGAGATGAGATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)