EMAIL THIS PAGE TO A FRIEND

MAN2C1

mannosidase, alpha, class 2C, member 1

52 Gene Product Result for
Synonyms: MAN6A8 MANA MANA1
Gene ID:
Mouse(73744) mannosidase, alpha, class 2C, member 1
Rat(246136) mannosidase, alpha, class 2C, member 1
sheep(101118225) mannosidase, alpha, class 2C, member 1
domestic guinea pig(100735430) mannosidase, alpha, class 2C, member 1
naked mole-rat(101717669) mannosidase, alpha, class 2C, member 1
chicken(415306) mannosidase, alpha, class 2C, member 1
cow(541086) mannosidase, alpha, class 2C, member 1
Horse(100061610) mannosidase, alpha, class 2C, member 1
domestic cat(101099049) mannosidase, alpha, class 2C, member 1
dog(611620) mannosidase, alpha, class 2C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006715 Rosetta Predictions human pricing
NM_139256 Rosetta Predictions rat pricing
NM_028636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342143 predicted 2038
2 SASI_Hs01_00132214 predicted 765
3 SASI_Hs01_00132215 predicted 661
4 SASI_Hs01_00132216 predicted 2180
5 SASI_Hs01_00132217 predicted 2865
6 SASI_Hs01_00132218 predicted 652
7 SASI_Hs01_00132220 predicted 2769
8 SASI_Hs01_00132221 predicted 364
9 SASI_Hs01_00132222 predicted 2768
10 SASI_Hs02_00342144 predicted 1493
11 SASI_Hs01_00132219 predicted 2195
12 SASI_Hs01_00132223 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268545 predicted 1563
2 SASI_Rn01_00041824 predicted 2326
3 SASI_Rn01_00041825 predicted 1066
4 SASI_Rn01_00041827 predicted 496
5 SASI_Rn01_00041828 predicted 1940
6 SASI_Rn01_00041829 predicted 1225
7 SASI_Rn01_00041830 predicted 2223
8 SASI_Rn01_00041831 predicted 2615
9 SASI_Rn01_00041832 predicted 2259
10 SASI_Rn01_00041833 predicted 2906
11 SASI_Rn01_00041826 predicted 1898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145295 predicted 2077
2 SASI_Mm01_00145296 predicted 1752
3 SASI_Mm01_00145297 predicted 2182
4 SASI_Mm01_00145298 predicted 2867
5 SASI_Mm01_00145299 predicted 695
6 SASI_Mm01_00145300 predicted 2621
7 SASI_Mm01_00145301 predicted 1199
8 SASI_Mm01_00145302 predicted 2702
9 SASI_Mm01_00145303 predicted 2201
10 SASI_Mm01_00145304 predicted 2059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006715
MAN2C1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2C, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2184s21c1
Sequence:CCGGGGGAACCAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2518s21c1
Sequence:CCGGAGCGACCTACCCACTACAATACTCGAGTATTGTAGTGGGTAGGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-1810s21c1
Sequence:CCGGACATCCGTTCCCATGGCAATACTCGAGTATTGCCATGGGAACGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2526s1c1
Sequence:CCGGGCCACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-124s1c1
Sequence:CCGGCGATCTACTTCACCGACTGTACTCGAGTACAGTCGGTGAAGTAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-1238s1c1
Sequence:CCGGCCAGAAATTGAGCTGGAATTTCTCGAGAAATTCCAGCTCAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2762s1c1
Sequence:CCGGCGAGTTCACCTATGCACTGATCTCGAGATCAGTGCATAGGTGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-921s1c1
Sequence:CCGGCGGAACCCTGAGTTCATCTTTCTCGAGAAAGATGAACTCAGGGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006715
MAN2C1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2C, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2184s21c1
Sequence:CCGGGGGAACCAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2518s21c1
Sequence:CCGGAGCGACCTACCCACTACAATACTCGAGTATTGTAGTGGGTAGGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-1810s21c1
Sequence:CCGGACATCCGTTCCCATGGCAATACTCGAGTATTGCCATGGGAACGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2526s1c1
Sequence:CCGGGCCACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-124s1c1
Sequence:CCGGCGATCTACTTCACCGACTGTACTCGAGTACAGTCGGTGAAGTAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-1238s1c1
Sequence:CCGGCCAGAAATTGAGCTGGAATTTCTCGAGAAATTCCAGCTCAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2762s1c1
Sequence:CCGGCGAGTTCACCTATGCACTGATCTCGAGATCAGTGCATAGGTGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-921s1c1
Sequence:CCGGCGGAACCCTGAGTTCATCTTTCTCGAGAAAGATGAACTCAGGGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006715
MAN2C1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2C, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2184s21c1
Sequence:CCGGGGGAACCAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-2518s21c1
Sequence:CCGGAGCGACCTACCCACTACAATACTCGAGTATTGTAGTGGGTAGGTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006715.2-1810s21c1
Sequence:CCGGACATCCGTTCCCATGGCAATACTCGAGTATTGCCATGGGAACGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2526s1c1
Sequence:CCGGGCCACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-124s1c1
Sequence:CCGGCGATCTACTTCACCGACTGTACTCGAGTACAGTCGGTGAAGTAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-1238s1c1
Sequence:CCGGCCAGAAATTGAGCTGGAATTTCTCGAGAAATTCCAGCTCAATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-2762s1c1
Sequence:CCGGCGAGTTCACCTATGCACTGATCTCGAGATCAGTGCATAGGTGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006715.1-921s1c1
Sequence:CCGGCGGAACCCTGAGTTCATCTTTCTCGAGAAAGATGAACTCAGGGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028636
VALIDATED
MAN2C1 MISSION shRNA Bacterial Glycerol Stock
mannosidase, alpha, class 2C, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2479s21c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-362s21c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-1961s21c1
Sequence:CCGGTGGTGACAGTGCCAAGTATTGCTCGAGCAATACTTGGCACTGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2061s21c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2607s1c1
Sequence:CCGGCCTGCTCAACAACTGCAAGTACTCGAGTACTTGCAGTTGTTGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2061s1c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028636.1-3083s1c1
Sequence:CCGGCCTTCCAAGTGAGATCCCTATCTCGAGATAGGGATCTCACTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2479s1c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-362s1c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028636
VALIDATED
MAN2C1 MISSION shRNA shRNA Plasmid DNA
mannosidase, alpha, class 2C, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2479s21c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-362s21c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-1961s21c1
Sequence:CCGGTGGTGACAGTGCCAAGTATTGCTCGAGCAATACTTGGCACTGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2061s21c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2607s1c1
Sequence:CCGGCCTGCTCAACAACTGCAAGTACTCGAGTACTTGCAGTTGTTGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2061s1c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028636.1-3083s1c1
Sequence:CCGGCCTTCCAAGTGAGATCCCTATCTCGAGATAGGGATCTCACTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2479s1c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-362s1c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028636
VALIDATED
MAN2C1 MISSION shRNA Lentiviral Transduction Particles
mannosidase, alpha, class 2C, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2479s21c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-362s21c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-1961s21c1
Sequence:CCGGTGGTGACAGTGCCAAGTATTGCTCGAGCAATACTTGGCACTGTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028636.2-2061s21c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2607s1c1
Sequence:CCGGCCTGCTCAACAACTGCAAGTACTCGAGTACTTGCAGTTGTTGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2061s1c1
Sequence:CCGGCGGTTCTGTGACTTTGGACAACTCGAGTTGTCCAAAGTCACAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028636.1-3083s1c1
Sequence:CCGGCCTTCCAAGTGAGATCCCTATCTCGAGATAGGGATCTCACTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-2479s1c1
Sequence:CCGGGCTACCTATGAGATCCAGTTTCTCGAGAAACTGGATCTCATAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028636.1-362s1c1
Sequence:CCGGGTTTGACCAAAGAAGGCGAAACTCGAGTTTCGCCTTCTTTGGTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)