EMAIL THIS PAGE TO A FRIEND

MANBA

mannosidase, beta A, lysosomal

50 Gene Product Result for
Synonyms: MANB1
UniProtKB ID: O00462, Q96BC3, Q9NYX9
Gene ID:
Human(4126) Summary: This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
Mouse(110173) mannosidase, beta A, lysosomal
Rat(310864) mannosidase, beta A, lysosomal
Zebrafish(393128) mannosidase, beta A, lysosomal
cow(281909) mannosidase, beta A, lysosomal
domestic cat(101085628) mannosidase, beta A, lysosomal
dog(487883) mannosidase, beta A, lysosomal
chicken(422712) mannosidase, beta A, lysosomal
naked mole-rat(101712953) mannosidase, beta A, lysosomal
domestic guinea pig(100730347) mannosidase, beta A, lysosomal
Goat(100750234) mannosidase, beta A, lysosomal
sheep(101107963) mannosidase, beta A, lysosomal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005908 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005908 Rosetta Predictions human pricing
NM_001031655 Rosetta Predictions rat pricing
NM_027288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340521 predicted 1517
2 SASI_Hs01_00017754 predicted 2226
3 SASI_Hs01_00017755 predicted 877
4 SASI_Hs01_00017756 predicted 721
5 SASI_Hs01_00017757 predicted 992
6 SASI_Hs01_00017758 predicted 2641
7 SASI_Hs01_00017760 predicted 2683
8 SASI_Hs01_00017761 predicted 2023
9 SASI_Hs01_00017762 predicted 916
10 SASI_Hs01_00017763 predicted 1859
11 SASI_Hs01_00017759 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090743 predicted 371
2 SASI_Rn02_00203599 predicted 2197
3 SASI_Rn01_00090744 predicted 611
4 SASI_Rn01_00090745 predicted 640
5 SASI_Rn01_00090746 predicted 279
6 SASI_Rn01_00090747 predicted 1655
7 SASI_Rn01_00090748 predicted 1858
8 SASI_Rn01_00090750 predicted 1191
9 SASI_Rn01_00090751 predicted 1476
10 SASI_Rn01_00090752 predicted 1437
11 SASI_Rn01_00090749 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092851 predicted 274
2 SASI_Mm01_00092852 predicted 2102
3 SASI_Mm01_00092853 predicted 2253
4 SASI_Mm01_00092854 predicted 1706
5 SASI_Mm01_00092855 predicted 968
6 SASI_Mm01_00092856 predicted 1917
7 SASI_Mm01_00092857 predicted 1451
8 SASI_Mm01_00092859 predicted 689
9 SASI_Mm02_00331884 predicted 1241
10 SASI_Mm02_00331885 predicted 1539
11 SASI_Mm01_00092858 predicted 964
12 SASI_Mm01_00092860 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027288
VALIDATED
MANBA MISSION shRNA Bacterial Glycerol Stock
mannosidase, beta A, lysosomal
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027288.2-3112s1c1
Sequence:CCGGGCCTGAATGTTGTATCTGATTCTCGAGAATCAGATACAACATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-292s1c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-2486s1c1
Sequence:CCGGGCTCCCTTTGTTTGGTTGGATCTCGAGATCCAACCAAACAAAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1658s1c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1402s1c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1459s21c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1644s21c1
Sequence:CCGGGCATCCAGTATGGTGATATTCCTCGAGGAATATCACCATACTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-349s21c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027288.3-1715s21c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-3100s21c1
Sequence:CCGGGGGAACTCAGATCCTACAATACTCGAGTATTGTAGGATCTGAGTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027288
VALIDATED
MANBA MISSION shRNA shRNA Plasmid DNA
mannosidase, beta A, lysosomal
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027288.2-3112s1c1
Sequence:CCGGGCCTGAATGTTGTATCTGATTCTCGAGAATCAGATACAACATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-292s1c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-2486s1c1
Sequence:CCGGGCTCCCTTTGTTTGGTTGGATCTCGAGATCCAACCAAACAAAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1658s1c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1402s1c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1459s21c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1644s21c1
Sequence:CCGGGCATCCAGTATGGTGATATTCCTCGAGGAATATCACCATACTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-349s21c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027288.3-1715s21c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-3100s21c1
Sequence:CCGGGGGAACTCAGATCCTACAATACTCGAGTATTGTAGGATCTGAGTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027288
VALIDATED
MANBA MISSION shRNA Lentiviral Transduction Particles
mannosidase, beta A, lysosomal
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027288.2-3112s1c1
Sequence:CCGGGCCTGAATGTTGTATCTGATTCTCGAGAATCAGATACAACATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-292s1c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-2486s1c1
Sequence:CCGGGCTCCCTTTGTTTGGTTGGATCTCGAGATCCAACCAAACAAAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1658s1c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027288.2-1402s1c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1459s21c1
Sequence:CCGGCGTGAACTGGTTCCACGTAAACTCGAGTTTACGTGGAACCAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-1644s21c1
Sequence:CCGGGCATCCAGTATGGTGATATTCCTCGAGGAATATCACCATACTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-349s21c1
Sequence:CCGGGCAGAAGGTAAAGTTGATCTTCTCGAGAAGATCAACTTTACCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027288.3-1715s21c1
Sequence:CCGGGCTCGATTAGTGTCTGAATATCTCGAGATATTCAGACACTAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027288.3-3100s21c1
Sequence:CCGGGGGAACTCAGATCCTACAATACTCGAGTATTGTAGGATCTGAGTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005908
MANBA MISSION shRNA Bacterial Glycerol Stock
mannosidase, beta A, lysosomal
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1185s1c1
Sequence:CCGGCCGAGTAACCTCTGAGTTGTTCTCGAGAACAACTCAGAGGTTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1513s1c1
Sequence:CCGGCCAATCTACATCAAGGACTATCTCGAGATAGTCCTTGATGTAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2127s1c1
Sequence:CCGGGCTTCATTACTTTGCTCAGAACTCGAGTTCTGAGCAAAGTAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2596s1c1
Sequence:CCGGCCAGGGAGATTTAGTGACAATCTCGAGATTGTCACTAAATCTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-264s1c1
Sequence:CCGGCCAGGATTCTTACTACAGATTCTCGAGAATCTGTAGTAAGAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1607s21c1
Sequence:CCGGATTACGTCCAGTCCTACAAATCTCGAGATTTGTAGGACTGGACGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1022s21c1
Sequence:CCGGGAACTGGATGGAGGCTTAAATCTCGAGATTTAAGCCTCCATCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005908
MANBA MISSION shRNA shRNA Plasmid DNA
mannosidase, beta A, lysosomal
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1185s1c1
Sequence:CCGGCCGAGTAACCTCTGAGTTGTTCTCGAGAACAACTCAGAGGTTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1513s1c1
Sequence:CCGGCCAATCTACATCAAGGACTATCTCGAGATAGTCCTTGATGTAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2127s1c1
Sequence:CCGGGCTTCATTACTTTGCTCAGAACTCGAGTTCTGAGCAAAGTAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2596s1c1
Sequence:CCGGCCAGGGAGATTTAGTGACAATCTCGAGATTGTCACTAAATCTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-264s1c1
Sequence:CCGGCCAGGATTCTTACTACAGATTCTCGAGAATCTGTAGTAAGAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1607s21c1
Sequence:CCGGATTACGTCCAGTCCTACAAATCTCGAGATTTGTAGGACTGGACGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1022s21c1
Sequence:CCGGGAACTGGATGGAGGCTTAAATCTCGAGATTTAAGCCTCCATCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005908
MANBA MISSION shRNA Lentiviral Transduction Particles
mannosidase, beta A, lysosomal
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1185s1c1
Sequence:CCGGCCGAGTAACCTCTGAGTTGTTCTCGAGAACAACTCAGAGGTTACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-1513s1c1
Sequence:CCGGCCAATCTACATCAAGGACTATCTCGAGATAGTCCTTGATGTAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2127s1c1
Sequence:CCGGGCTTCATTACTTTGCTCAGAACTCGAGTTCTGAGCAAAGTAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-2596s1c1
Sequence:CCGGCCAGGGAGATTTAGTGACAATCTCGAGATTGTCACTAAATCTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005908.2-264s1c1
Sequence:CCGGCCAGGATTCTTACTACAGATTCTCGAGAATCTGTAGTAAGAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1607s21c1
Sequence:CCGGATTACGTCCAGTCCTACAAATCTCGAGATTTGTAGGACTGGACGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005908.3-1022s21c1
Sequence:CCGGGAACTGGATGGAGGCTTAAATCTCGAGATTTAAGCCTCCATCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)