EMAIL THIS PAGE TO A FRIEND

MANEA

mannosidase, endo-alpha

56 Gene Product Result for
Synonyms: ENDO hEndo
Gene ID:
Human(79694) Summary: N-glycosylation of proteins is initiated in the endoplasmic reticulum (ER) by the transfer of the preassembled oligosaccharide glucose-3-mannose-9-N-acetylglucosamine-2 from dolichyl pyrophosphate to acceptor sites on the target protein by an oligosaccharyltransferase complex. This core oligosaccharide is sequentially processed by several ER glycosidases and by an endomannosidase (E.C. 3.2.1.130), such as MANEA, in the Golgi. MANEA catalyzes the release of mono-, di-, and triglucosylmannose oligosaccharides by cleaving the alpha-1,2-mannosidic bond that links them to high-mannose glycans (Hamilton et al., 2005 [PubMed 15677381]
Mouse(242362) mannosidase, endo-alpha
Rat(140808) mannosidase, endo-alpha
sheep(101106778) mannosidase, endo-alpha
naked mole-rat(101724745) mannosidase, endo-alpha
domestic guinea pig(100718937) mannosidase, endo-alpha
Zebrafish(447827) mannosidase, endo-alpha
chicken(421807) mannosidase, endo-alpha
domestic cat(101101567) mannosidase, endo-alpha
Horse(100065922) mannosidase, endo-alpha
dog(481925) mannosidase, endo-alpha
cow(512853) mannosidase, endo-alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024641 Rosetta Predictions human pricing
NM_080785 Rosetta Predictions rat pricing
NM_172865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135263 predicted 1015
2 SASI_Hs01_00135264 predicted 942
3 SASI_Hs01_00135265 predicted 803
4 SASI_Hs02_00357025 predicted 1198
5 SASI_Hs01_00135268 predicted 1028
6 SASI_Hs01_00135269 predicted 635
7 SASI_Hs01_00135270 predicted 420
8 SASI_Hs01_00135271 predicted 1058
9 SASI_Hs01_00135272 predicted 1405
10 SASI_Hs02_00357026 predicted 1136
11 SASI_Hs01_00135266 predicted 429
12 SASI_Hs01_00135267 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041975 predicted 492
2 SASI_Rn02_00267306 predicted 621
3 SASI_Rn02_00267307 predicted 928
4 SASI_Rn02_00267308 predicted 997
5 SASI_Rn02_00267309 predicted 423
6 SASI_Rn02_00267310 predicted 834
7 SASI_Rn02_00267311 predicted 888
8 SASI_Rn01_00041981 predicted 663
9 SASI_Rn02_00267312 predicted 1051
10 SASI_Rn02_00267313 predicted 630
11 SASI_Rn01_00041974 predicted 485
12 SASI_Rn01_00041976 predicted 1531
13 SASI_Rn01_00041977 predicted 1119
14 SASI_Rn01_00041978 predicted 851
15 SASI_Rn01_00041979 predicted 1396
16 SASI_Rn01_00041980 predicted 1310
17 SASI_Rn01_00041982 predicted 1475
18 SASI_Rn01_00041983 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168529 predicted 588
2 SASI_Mm01_00168530 predicted 425
3 SASI_Mm01_00168531 predicted 1226
4 SASI_Mm01_00168532 predicted 493
5 SASI_Mm01_00168533 predicted 933
6 SASI_Mm01_00168534 predicted 752
7 SASI_Mm01_00168536 predicted 368
8 SASI_Mm01_00168537 predicted 523
9 SASI_Mm01_00168538 predicted 966
10 SASI_Mm02_00344826 predicted 915
11 SASI_Mm01_00168535 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172865
VALIDATED
MANEA MISSION shRNA Bacterial Glycerol Stock
mannosidase, endo-alpha
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-491s1c1
Sequence:CCGGCCTCGGATAGCCAAGAACTATCTCGAGATAGTTCTTGGCTATCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172865.2-2457s1c1
Sequence:CCGGCCATTGTTTCTCAGTGGTTAACTCGAGTTAACCACTGAGAAACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1164s1c1
Sequence:CCGGGCCCAGGATACATAGATACAACTCGAGTTGTATCTATGTATCCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-3683s21c1
Sequence:CCGGAGAATAAGTCTACGCAAATAACTCGAGTTATTTGCGTAGACTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1234s1c1
Sequence:CCGGGTATTATGAAGTTGGTCTAAGCTCGAGCTTAGACCAACTTCATAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-921s1c1
Sequence:CCGGCAATATGGGCCAATCTGTTAACTCGAGTTAACAGATTGGCCCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1379s1c1
Sequence:CCGGCCTCATAAGCCAAGTCTTTATCTCGAGATAAAGACTTGGCTTATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-1158s21c1
Sequence:CCGGGTGTAGGCCCAGGATACATAGCTCGAGCTATGTATCCTGGGCCTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-525s21c1
Sequence:CCGGATAGTCCTCCAGACGACATTGCTCGAGCAATGTCGTCTGGAGGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-906s21c1
Sequence:CCGGACATCACAAAGCCTACAATATCTCGAGATATTGTAGGCTTTGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-230s21c1
Sequence:CCGGCCAGAACTTCATCCACTAAATCTCGAGATTTAGTGGATGAAGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172865
VALIDATED
MANEA MISSION shRNA shRNA Plasmid DNA
mannosidase, endo-alpha
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-491s1c1
Sequence:CCGGCCTCGGATAGCCAAGAACTATCTCGAGATAGTTCTTGGCTATCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172865.2-2457s1c1
Sequence:CCGGCCATTGTTTCTCAGTGGTTAACTCGAGTTAACCACTGAGAAACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1164s1c1
Sequence:CCGGGCCCAGGATACATAGATACAACTCGAGTTGTATCTATGTATCCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-3683s21c1
Sequence:CCGGAGAATAAGTCTACGCAAATAACTCGAGTTATTTGCGTAGACTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1234s1c1
Sequence:CCGGGTATTATGAAGTTGGTCTAAGCTCGAGCTTAGACCAACTTCATAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-921s1c1
Sequence:CCGGCAATATGGGCCAATCTGTTAACTCGAGTTAACAGATTGGCCCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1379s1c1
Sequence:CCGGCCTCATAAGCCAAGTCTTTATCTCGAGATAAAGACTTGGCTTATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-1158s21c1
Sequence:CCGGGTGTAGGCCCAGGATACATAGCTCGAGCTATGTATCCTGGGCCTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-525s21c1
Sequence:CCGGATAGTCCTCCAGACGACATTGCTCGAGCAATGTCGTCTGGAGGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-906s21c1
Sequence:CCGGACATCACAAAGCCTACAATATCTCGAGATATTGTAGGCTTTGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-230s21c1
Sequence:CCGGCCAGAACTTCATCCACTAAATCTCGAGATTTAGTGGATGAAGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172865
VALIDATED
MANEA MISSION shRNA Lentiviral Transduction Particles
mannosidase, endo-alpha
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-491s1c1
Sequence:CCGGCCTCGGATAGCCAAGAACTATCTCGAGATAGTTCTTGGCTATCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172865.2-2457s1c1
Sequence:CCGGCCATTGTTTCTCAGTGGTTAACTCGAGTTAACCACTGAGAAACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1164s1c1
Sequence:CCGGGCCCAGGATACATAGATACAACTCGAGTTGTATCTATGTATCCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-3683s21c1
Sequence:CCGGAGAATAAGTCTACGCAAATAACTCGAGTTATTTGCGTAGACTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1234s1c1
Sequence:CCGGGTATTATGAAGTTGGTCTAAGCTCGAGCTTAGACCAACTTCATAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-921s1c1
Sequence:CCGGCAATATGGGCCAATCTGTTAACTCGAGTTAACAGATTGGCCCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172865.2-1379s1c1
Sequence:CCGGCCTCATAAGCCAAGTCTTTATCTCGAGATAAAGACTTGGCTTATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-1158s21c1
Sequence:CCGGGTGTAGGCCCAGGATACATAGCTCGAGCTATGTATCCTGGGCCTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-525s21c1
Sequence:CCGGATAGTCCTCCAGACGACATTGCTCGAGCAATGTCGTCTGGAGGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-906s21c1
Sequence:CCGGACATCACAAAGCCTACAATATCTCGAGATATTGTAGGCTTTGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172865.2-230s21c1
Sequence:CCGGCCAGAACTTCATCCACTAAATCTCGAGATTTAGTGGATGAAGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024641
VALIDATED
MANEA MISSION shRNA Bacterial Glycerol Stock
mannosidase, endo-alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-536s1c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1422s1c1
Sequence:CCGGCGTCCTCATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1265s1c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-402s1c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-3570s1c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-402s21c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-536s21c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024641.2-3570s21c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-1265s21c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024641
VALIDATED
MANEA MISSION shRNA shRNA Plasmid DNA
mannosidase, endo-alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-536s1c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1422s1c1
Sequence:CCGGCGTCCTCATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1265s1c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-402s1c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-3570s1c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-402s21c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-536s21c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024641.2-3570s21c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-1265s21c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024641
VALIDATED
MANEA MISSION shRNA Lentiviral Transduction Particles
mannosidase, endo-alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-536s1c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1422s1c1
Sequence:CCGGCGTCCTCATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024641.2-1265s1c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-402s1c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024641.2-3570s1c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-402s21c1
Sequence:CCGGGCCTCTGAACTTAACTTGGATCTCGAGATCCAAGTTAAGTTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-536s21c1
Sequence:CCGGCCCTAGAATAGCCAAGAATTACTCGAGTAATTCTTGGCTATTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024641.2-3570s21c1
Sequence:CCGGCCCATTATAGACATGGTGAATCTCGAGATTCACCATGTCTATAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024641.2-1265s21c1
Sequence:CCGGCCGAATCAATGGGAAGTATTACTCGAGTAATACTTCCCATTGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)