EMAIL THIS PAGE TO A FRIEND

MANEAL

mannosidase, endo-alpha-like

137 Gene Product Result for
Synonyms: RP11-109P14.3
UniProtKB ID: Q5VSG8, Q6DD86, Q6P497, Q8N5P8, Q96G55, Q96N42
Gene ID:
Mouse(215090) mannosidase, endo-alpha-like
chicken(419611) mannosidase, endo-alpha-like
domestic cat(101092036) mannosidase, endo-alpha-like
cow(526978) mannosidase, endo-alpha-like
dog(482470) mannosidase, endo-alpha-like
domestic guinea pig(100721941) mannosidase, endo-alpha-like
naked mole-rat(101702549) mannosidase, endo-alpha-like
sheep(101115836) mannosidase, endo-alpha-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA063423 Anti-MANEAL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070381 MISSION® esiRNA esiRNA human MANEAL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031740 Rosetta Predictions human pricing
NM_001113482 Rosetta Predictions human pricing
NM_152496 Rosetta Predictions human pricing
NM_001007573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120312 predicted 1190
2 SASI_Hs01_00120313 predicted 1071
3 SASI_Hs02_00307802 predicted 1268
4 SASI_Hs01_00120314 predicted 1180
5 SASI_Hs01_00120315 predicted 1273
6 SASI_Hs01_00120316 predicted 1030
7 SASI_Hs01_00120318 predicted 1293
8 SASI_Hs01_00120317 predicted 1291
9 SASI_Hs02_00307803 predicted 1088
10 SASI_Hs01_00120319 predicted 783
11 SASI_Hs01_00120320 predicted 896
12 SASI_Hs01_00120321 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325871 predicted 1464
2 SASI_Hs02_00325872 predicted 1351
3 SASI_Hs02_00325873 predicted 1542
4 SASI_Hs02_00325874 predicted 1454
5 SASI_Hs02_00325875 predicted 1558
6 SASI_Hs02_00325876 predicted 1703
7 SASI_Hs02_00325877 predicted 1308
8 SASI_Hs02_00325878 predicted 1780
9 SASI_Hs02_00325879 predicted 1714
10 SASI_Hs02_00325880 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170899 predicted 1004
2 SASI_Hs01_00170900 predicted 886
3 SASI_Hs02_00366273 predicted 1082
4 SASI_Hs01_00170901 predicted 992
5 SASI_Hs01_00170902 predicted 1097
6 SASI_Hs01_00170903 predicted 1247
7 SASI_Hs01_00170904 predicted 849
8 SASI_Hs01_00170905 predicted 1321
9 SASI_Hs01_00170906 predicted 1250
10 SASI_Hs01_00170908 predicted 1112
11 SASI_Hs01_00170907 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107672 predicted 1042
2 SASI_Mm01_00107673 predicted 724
3 SASI_Mm01_00107674 predicted 1046
4 SASI_Mm01_00107675 predicted 1192
5 SASI_Mm01_00107676 predicted 687
6 SASI_Mm02_00286753 predicted 1196
7 SASI_Mm01_00107677 predicted 1233
8 SASI_Mm01_00107678 predicted 1205
9 SASI_Mm01_00107679 predicted 955
10 SASI_Mm01_00107680 predicted 568
11 SASI_Mm01_00107671 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152496
VALIDATED
MANEAL MISSION shRNA Bacterial Glycerol Stock
mannosidase, endo-alpha-like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-809s21c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-956s21c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152496.2-1256s21c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-956s1c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-1256s1c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152496.1-2021s1c1
Sequence:CCGGCCACAACAAGTAGGTTTGCTTCTCGAGAAGCAAACCTACTTGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-636s1c1
Sequence:CCGGGAACTGGAAAGCTGTGAAGAACTCGAGTTCTTCACAGCTTTCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-809s1c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-667s1c1
Sequence:CCGGGCCAACAACCTCATGTTCATCCTCGAGGATGAACATGAGGTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-732s21c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-732s1c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-750s1c1
Sequence:CCGGCAACAGGGTCAATGGCAAGTACTCGAGTACTTGCCATTGACCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-813s1c1
Sequence:CCGGGATCGTTTCCATTACCTCCTTCTCGAGAAGGAGGTAATGGAAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-816s1c1
Sequence:CCGGCGTTTCCATTACCTCCTTCAACTCGAGTTGAAGGAGGTAATGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152496
VALIDATED
MANEAL MISSION shRNA shRNA Plasmid DNA
mannosidase, endo-alpha-like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-809s21c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-956s21c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152496.2-1256s21c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-956s1c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-1256s1c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152496.1-2021s1c1
Sequence:CCGGCCACAACAAGTAGGTTTGCTTCTCGAGAAGCAAACCTACTTGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-636s1c1
Sequence:CCGGGAACTGGAAAGCTGTGAAGAACTCGAGTTCTTCACAGCTTTCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-809s1c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-667s1c1
Sequence:CCGGGCCAACAACCTCATGTTCATCCTCGAGGATGAACATGAGGTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-732s21c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-732s1c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-750s1c1
Sequence:CCGGCAACAGGGTCAATGGCAAGTACTCGAGTACTTGCCATTGACCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-813s1c1
Sequence:CCGGGATCGTTTCCATTACCTCCTTCTCGAGAAGGAGGTAATGGAAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-816s1c1
Sequence:CCGGCGTTTCCATTACCTCCTTCAACTCGAGTTGAAGGAGGTAATGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152496
VALIDATED
MANEAL MISSION shRNA Lentiviral Transduction Particles
mannosidase, endo-alpha-like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-809s21c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-956s21c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152496.2-1256s21c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-956s1c1
Sequence:CCGGCGGAGCACTTCATCAAAGAGACTCGAGTCTCTTTGATGAAGTGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-1256s1c1
Sequence:CCGGCCTGGGAACACTTTCATGTAACTCGAGTTACATGAAAGTGTTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152496.1-2021s1c1
Sequence:CCGGCCACAACAAGTAGGTTTGCTTCTCGAGAAGCAAACCTACTTGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-636s1c1
Sequence:CCGGGAACTGGAAAGCTGTGAAGAACTCGAGTTCTTCACAGCTTTCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-809s1c1
Sequence:CCGGCCGAGATCGTTTCCATTACCTCTCGAGAGGTAATGGAAACGATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-667s1c1
Sequence:CCGGGCCAACAACCTCATGTTCATCCTCGAGGATGAACATGAGGTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152496.2-732s21c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-732s1c1
Sequence:CCGGGAACAACCACAATACGCGCAACTCGAGTTGCGCGTATTGTGGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-750s1c1
Sequence:CCGGCAACAGGGTCAATGGCAAGTACTCGAGTACTTGCCATTGACCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152496.1-813s1c1
Sequence:CCGGGATCGTTTCCATTACCTCCTTCTCGAGAAGGAGGTAATGGAAACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152496.1-816s1c1
Sequence:CCGGCGTTTCCATTACCTCCTTCAACTCGAGTTGAAGGAGGTAATGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007573
MANEAL MISSION shRNA Bacterial Glycerol Stock
mannosidase, endo-alpha-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007573.1-2568s1c1
Sequence:CCGGGCTGGATTTAACCCTGCATATCTCGAGATATGCAGGGTTAAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-1233s1c1
Sequence:CCGGGAGGGCACACAGATTGAGAAACTCGAGTTTCTCAATCTGTGTGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007573.1-1814s21c1
Sequence:CCGGACCCATACTAAGCACCTATTGCTCGAGCAATAGGTGCTTAGTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1129s21c1
Sequence:CCGGATACTCGGAACCGGGTCAATGCTCGAGCATTGACCCGGTTCCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-767s1c1
Sequence:CCGGCTACCGTTACAAGAATAGCATCTCGAGATGCTATTCTTGTAACGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-586s21c1
Sequence:CCGGCTGGCATGGCTGATGATAATGCTCGAGCATTATCATCAGCCATGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1300s21c1
Sequence:CCGGCTCACCAGTCCAGCCTGTATTCTCGAGAATACAGGCTGGACTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-967s21c1
Sequence:CCGGACGGAATGTACACCTACTTTGCTCGAGCAAAGTAGGTGTACATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007573
MANEAL MISSION shRNA shRNA Plasmid DNA
mannosidase, endo-alpha-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007573.1-2568s1c1
Sequence:CCGGGCTGGATTTAACCCTGCATATCTCGAGATATGCAGGGTTAAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-1233s1c1
Sequence:CCGGGAGGGCACACAGATTGAGAAACTCGAGTTTCTCAATCTGTGTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007573.1-1814s21c1
Sequence:CCGGACCCATACTAAGCACCTATTGCTCGAGCAATAGGTGCTTAGTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1129s21c1
Sequence:CCGGATACTCGGAACCGGGTCAATGCTCGAGCATTGACCCGGTTCCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-767s1c1
Sequence:CCGGCTACCGTTACAAGAATAGCATCTCGAGATGCTATTCTTGTAACGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-586s21c1
Sequence:CCGGCTGGCATGGCTGATGATAATGCTCGAGCATTATCATCAGCCATGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1300s21c1
Sequence:CCGGCTCACCAGTCCAGCCTGTATTCTCGAGAATACAGGCTGGACTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-967s21c1
Sequence:CCGGACGGAATGTACACCTACTTTGCTCGAGCAAAGTAGGTGTACATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007573
MANEAL MISSION shRNA Lentiviral Transduction Particles
mannosidase, endo-alpha-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007573.1-2568s1c1
Sequence:CCGGGCTGGATTTAACCCTGCATATCTCGAGATATGCAGGGTTAAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-1233s1c1
Sequence:CCGGGAGGGCACACAGATTGAGAAACTCGAGTTTCTCAATCTGTGTGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007573.1-1814s21c1
Sequence:CCGGACCCATACTAAGCACCTATTGCTCGAGCAATAGGTGCTTAGTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1129s21c1
Sequence:CCGGATACTCGGAACCGGGTCAATGCTCGAGCATTGACCCGGTTCCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007573.1-767s1c1
Sequence:CCGGCTACCGTTACAAGAATAGCATCTCGAGATGCTATTCTTGTAACGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-586s21c1
Sequence:CCGGCTGGCATGGCTGATGATAATGCTCGAGCATTATCATCAGCCATGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-1300s21c1
Sequence:CCGGCTCACCAGTCCAGCCTGTATTCTCGAGAATACAGGCTGGACTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007573.1-967s21c1
Sequence:CCGGACGGAATGTACACCTACTTTGCTCGAGCAAAGTAGGTGTACATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)