EMAIL THIS PAGE TO A FRIEND

MANF

mesencephalic astrocyte-derived neurotrophic factor

69 Gene Product Result for
Synonyms: ARMET ARP
UniProtKB ID: P55145, Q14CX4, Q86U67, Q96IS4
Gene ID:
Human(7873) Summary: The protein encoded by this gene is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. Reducing expression of this gene increases susceptibility to ER stress-induced death and promotes cell proliferation. The protein was initially thought to be longer at the N-terminus and to contain an arginine-rich region but transcribed evidence indicates a smaller open reading frame that does not encode the arginine tract. The presence of polymorphisms in the arginine-rich region, including a specific mutation that changes the previously numbered codon 50 from ATG to AGG, have been reported in a variety of solid tumors; however, these polymorphisms were later shown to exist in normal tissues and are thus not tumor-related. [provided by RefSeq, Jun 2010]
Mouse(74840) mesencephalic astrocyte-derived neurotrophic factor
Rat(315989) mesencephalic astrocyte-derived neurotrophic factor
sheep(101118227) mesencephalic astrocyte-derived neurotrophic factor
naked mole-rat(101719750) mesencephalic astrocyte-derived neurotrophic factor
domestic guinea pig(100719906) mesencephalic astrocyte-derived neurotrophic factor
Zebrafish(767691) mesencephalic astrocyte-derived neurotrophic factor
fruit fly(41983) Mesencephalic astrocyte-derived neurotrophic factor
cow(540432) mesencephalic astrocyte-derived neurotrophic factor
Horse(100052301) mesencephalic astrocyte-derived neurotrophic factor
dog(608421) mesencephalic astrocyte-derived neurotrophic factor
chicken(770664) mesencephalic astrocyte-derived neurotrophic factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006010 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026851 MISSION® esiRNA esiRNA targeting mouse Armet (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006010 siRNAs that have been validated in the lab human pricing
NM_001108183 Rosetta Predictions rat pricing
NM_029103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006010 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234967 validated 611
2 SASI_Hs01_00234966 predicted 304
3 SASI_Hs01_00234968 predicted 518
4 SASI_Hs01_00234969 predicted 440
5 SASI_Hs01_00234970 predicted 603
6 SASI_Hs01_00234971 predicted 363
7 SASI_Hs01_00234972 predicted 404
8 SASI_Hs01_00234973 predicted 410
9 SASI_Hs01_00234974 predicted 604
10 SASI_Hs01_00234975 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236154 predicted 218
2 SASI_Rn02_00236155 predicted 246
3 SASI_Rn02_00236156 predicted 216
4 SASI_Rn02_00236157 predicted 299
5 SASI_Rn02_00236158 predicted 296
6 SASI_Rn02_00236159 predicted 240
7 SASI_Rn02_00236160 predicted 266
8 SASI_Rn02_00236161 predicted 264
9 SASI_Rn02_00236162 predicted 209
10 SASI_Rn02_00236163 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188892 predicted 239
2 SASI_Mm01_00188893 predicted 319
3 SASI_Mm01_00188897 predicted 585
4 SASI_Mm01_00188898 predicted 253
5 SASI_Mm02_00334877 predicted 793
6 SASI_Mm02_00334878 predicted 896
7 SASI_Mm02_00334879 predicted 877
8 SASI_Mm02_00334880 predicted 874
9 SASI_Mm02_00334881 predicted 876
10 SASI_Mm02_00334882 predicted 987
11 SASI_Mm01_00188889 predicted 199
12 SASI_Mm01_00188890 predicted 301
13 SASI_Mm01_00188891 predicted 227
14 SASI_Mm01_00188894 predicted 262
15 SASI_Mm01_00188895 predicted 215
16 SASI_Mm01_00188896 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029103
VALIDATED
MANF MISSION shRNA Bacterial Glycerol Stock
mesencephalic astrocyte-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-107s1c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-650s1c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-481s1c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-222s1c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-133s1c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-129s21c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-503s21c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029103.3-672s21c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-244s21c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-155s21c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029103
VALIDATED
MANF MISSION shRNA shRNA Plasmid DNA
mesencephalic astrocyte-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-107s1c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-650s1c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-481s1c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-222s1c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-133s1c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-129s21c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-503s21c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029103.3-672s21c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-244s21c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-155s21c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029103
VALIDATED
MANF MISSION shRNA Lentiviral Transduction Particles
mesencephalic astrocyte-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-107s1c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-650s1c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-481s1c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029103.1-222s1c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029103.1-133s1c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-129s21c1
Sequence:CCGGGTATTTCTTATCTGGGACGATCTCGAGATCGTCCCAGATAAGAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-503s21c1
Sequence:CCGGTCTGACTATATCCGGAAGATACTCGAGTATCTTCCGGATATAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029103.3-672s21c1
Sequence:CCGGCTCCTGACAATGAGATGTGAACTCGAGTTCACATCTCATTGTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-244s21c1
Sequence:CCGGGAATCGGTTGTGCTACTACATCTCGAGATGTAGTAGCACAACCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029103.3-155s21c1
Sequence:CCGGCAGGACCTCAAAGACAGAGATCTCGAGATCTCTGTCTTTGAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006010
VALIDATED
MANF MISSION shRNA Bacterial Glycerol Stock
mesencephalic astrocyte-derived neurotrophic factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-284s21c1
Sequence:CCGGGAATCGGTTGTGCTACTATATCTCGAGATATAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.3-465s21c1
Sequence:CCGGCTGAAGAAGCTCCGAGTTAAACTCGAGTTTAACTCGGAGCTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-776s1c1
Sequence:CCGGAGATAAATGAACTGATGCCTACTCGAGTAGGCATCAGTTCATTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-642s1c1
Sequence:CCGGGCTTAAGTATGACAAGCAGATCTCGAGATCTGCTTGTCATACTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006010.1-386s1c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-693s1c1
Sequence:CCGGCCGAGTTAAAGAGCTGAAGAACTCGAGTTCTTCAGCTCTTTAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-703s21c1
Sequence:CCGGTTAAGTGGGCTCCTGACAATACTCGAGTATTGTCAGGAGCCCACTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-333s21c1
Sequence:CCGGATCATCAATGAGGTATCAAAGCTCGAGCTTTGATACCTCATTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006010.2-169s21c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-220s21c1
Sequence:CCGGCATTCTCACCAGCCACTATTGCTCGAGCAATAGTGGCTGGTGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006010
VALIDATED
MANF MISSION shRNA shRNA Plasmid DNA
mesencephalic astrocyte-derived neurotrophic factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-284s21c1
Sequence:CCGGGAATCGGTTGTGCTACTATATCTCGAGATATAGTAGCACAACCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.3-465s21c1
Sequence:CCGGCTGAAGAAGCTCCGAGTTAAACTCGAGTTTAACTCGGAGCTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-776s1c1
Sequence:CCGGAGATAAATGAACTGATGCCTACTCGAGTAGGCATCAGTTCATTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-642s1c1
Sequence:CCGGGCTTAAGTATGACAAGCAGATCTCGAGATCTGCTTGTCATACTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006010.1-386s1c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-693s1c1
Sequence:CCGGCCGAGTTAAAGAGCTGAAGAACTCGAGTTCTTCAGCTCTTTAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-703s21c1
Sequence:CCGGTTAAGTGGGCTCCTGACAATACTCGAGTATTGTCAGGAGCCCACTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-333s21c1
Sequence:CCGGATCATCAATGAGGTATCAAAGCTCGAGCTTTGATACCTCATTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006010.2-169s21c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-220s21c1
Sequence:CCGGCATTCTCACCAGCCACTATTGCTCGAGCAATAGTGGCTGGTGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006010
VALIDATED
MANF MISSION shRNA Lentiviral Transduction Particles
mesencephalic astrocyte-derived neurotrophic factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-284s21c1
Sequence:CCGGGAATCGGTTGTGCTACTATATCTCGAGATATAGTAGCACAACCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.3-465s21c1
Sequence:CCGGCTGAAGAAGCTCCGAGTTAAACTCGAGTTTAACTCGGAGCTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-776s1c1
Sequence:CCGGAGATAAATGAACTGATGCCTACTCGAGTAGGCATCAGTTCATTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-642s1c1
Sequence:CCGGGCTTAAGTATGACAAGCAGATCTCGAGATCTGCTTGTCATACTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006010.1-386s1c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006010.1-693s1c1
Sequence:CCGGCCGAGTTAAAGAGCTGAAGAACTCGAGTTCTTCAGCTCTTTAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-703s21c1
Sequence:CCGGTTAAGTGGGCTCCTGACAATACTCGAGTATTGTCAGGAGCCCACTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-333s21c1
Sequence:CCGGATCATCAATGAGGTATCAAAGCTCGAGCTTTGATACCTCATTGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006010.2-169s21c1
Sequence:CCGGGTATTTCTTATCTGGGAAGATCTCGAGATCTTCCCAGATAAGAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006010.2-220s21c1
Sequence:CCGGCATTCTCACCAGCCACTATTGCTCGAGCAATAGTGGCTGGTGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)