EMAIL THIS PAGE TO A FRIEND

MANSC1

MANSC domain containing 1

68 Gene Product Result for
Synonyms: 9130403P13Rik LOH12CR3
UniProtKB ID: Q9H8J5, Q8NEC1
Gene ID:
Mouse(67729) MANSC domain containing 1
Rat(690606) MANSC domain containing 1
sheep(101112719) MANSC domain containing 1
domestic guinea pig(100728052) MANSC domain containing 1
naked mole-rat(101702735) MANSC domain containing 1
chicken(426428) MANSC domain containing 1
domestic cat(101091288) MANSC domain containing 1
cow(512999) MANSC domain containing 1
dog(611242) MANSC domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018050 Rosetta Predictions human pricing
NM_001109603 Rosetta Predictions rat pricing
NM_026345 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202347 predicted 1140
2 SASI_Hs01_00202348 predicted 1198
3 SASI_Hs01_00202349 predicted 481
4 SASI_Hs01_00202351 predicted 277
5 SASI_Hs01_00202356 predicted 596
6 SASI_Hs02_00351180 predicted 745
7 SASI_Hs02_00351181 predicted 1412
8 SASI_Hs02_00351182 predicted 1275
9 SASI_Hs02_00351183 predicted 1062
10 SASI_Hs02_00351184 predicted 485
11 SASI_Hs01_00202350 predicted 810
12 SASI_Hs01_00202352 predicted 416
13 SASI_Hs01_00202353 predicted 430
14 SASI_Hs01_00202354 predicted 892
15 SASI_Hs01_00202355 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249997 predicted 512
2 SASI_Rn02_00249998 predicted 770
3 SASI_Rn02_00249999 predicted 406
4 SASI_Rn02_00250000 predicted 817
5 SASI_Rn02_00250001 predicted 472
6 SASI_Rn02_00250002 predicted 769
7 SASI_Rn02_00250003 predicted 1293
8 SASI_Rn02_00250004 predicted 623
9 SASI_Rn02_00250005 predicted 431
10 SASI_Rn02_00250006 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134250 predicted 1230
2 SASI_Mm01_00134251 predicted 391
3 SASI_Mm01_00134252 predicted 968
4 SASI_Mm02_00330062 predicted 598
5 SASI_Mm01_00134253 predicted 479
6 SASI_Mm01_00134254 predicted 1247
7 SASI_Mm01_00134255 predicted 1259
8 SASI_Mm01_00134256 predicted 1112
9 SASI_Mm01_00134257 predicted 1242
10 SASI_Mm02_00330063 predicted 739
11 SASI_Mm01_00134258 predicted 521
12 SASI_Mm01_00134259 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018050
VALIDATED
MANSC1 MISSION shRNA Bacterial Glycerol Stock
MANSC domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-1505s21c1
Sequence:CCGGGTTACTCAAGACTGGATTATTCTCGAGAATAATCCAGTCTTGAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-407s21c1
Sequence:CCGGGAGGCAATGAGCCCGTATATACTCGAGTATATACGGGCTCATTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018050.2-1228s21c1
Sequence:CCGGGAAATCTCCAACCTAACTTTGCTCGAGCAAAGTTAGGTTGGAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-532s21c1
Sequence:CCGGCAACCCAACTGCTACCTATTTCTCGAGAAATAGGTAGCAGTTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018050.2-1629s21c1
Sequence:CCGGGTCTTAGCAGGAGGTTGTATTCTCGAGAATACAACCTCCTGCTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-667s1c1
Sequence:CCGGCAGGAAGATTCTCTCTTACATCTCGAGATGTAAGAGAGAATCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1504s1c1
Sequence:CCGGCGTTACTCAAGACTGGATTATCTCGAGATAATCCAGTCTTGAGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1097s1c1
Sequence:CCGGCGACCCTCATTTCTACAGTTTCTCGAGAAACTGTAGAAATGAGGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018050
VALIDATED
MANSC1 MISSION shRNA shRNA Plasmid DNA
MANSC domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-1505s21c1
Sequence:CCGGGTTACTCAAGACTGGATTATTCTCGAGAATAATCCAGTCTTGAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-407s21c1
Sequence:CCGGGAGGCAATGAGCCCGTATATACTCGAGTATATACGGGCTCATTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018050.2-1228s21c1
Sequence:CCGGGAAATCTCCAACCTAACTTTGCTCGAGCAAAGTTAGGTTGGAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-532s21c1
Sequence:CCGGCAACCCAACTGCTACCTATTTCTCGAGAAATAGGTAGCAGTTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018050.2-1629s21c1
Sequence:CCGGGTCTTAGCAGGAGGTTGTATTCTCGAGAATACAACCTCCTGCTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-667s1c1
Sequence:CCGGCAGGAAGATTCTCTCTTACATCTCGAGATGTAAGAGAGAATCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1504s1c1
Sequence:CCGGCGTTACTCAAGACTGGATTATCTCGAGATAATCCAGTCTTGAGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1097s1c1
Sequence:CCGGCGACCCTCATTTCTACAGTTTCTCGAGAAACTGTAGAAATGAGGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018050
VALIDATED
MANSC1 MISSION shRNA Lentiviral Transduction Particles
MANSC domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-1505s21c1
Sequence:CCGGGTTACTCAAGACTGGATTATTCTCGAGAATAATCCAGTCTTGAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-407s21c1
Sequence:CCGGGAGGCAATGAGCCCGTATATACTCGAGTATATACGGGCTCATTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018050.2-1228s21c1
Sequence:CCGGGAAATCTCCAACCTAACTTTGCTCGAGCAAAGTTAGGTTGGAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018050.2-532s21c1
Sequence:CCGGCAACCCAACTGCTACCTATTTCTCGAGAAATAGGTAGCAGTTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018050.2-1629s21c1
Sequence:CCGGGTCTTAGCAGGAGGTTGTATTCTCGAGAATACAACCTCCTGCTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-667s1c1
Sequence:CCGGCAGGAAGATTCTCTCTTACATCTCGAGATGTAAGAGAGAATCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1504s1c1
Sequence:CCGGCGTTACTCAAGACTGGATTATCTCGAGATAATCCAGTCTTGAGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018050.2-1097s1c1
Sequence:CCGGCGACCCTCATTTCTACAGTTTCTCGAGAAACTGTAGAAATGAGGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026345
MANSC1 MISSION shRNA Bacterial Glycerol Stock
MANSC domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026345.2-1626s1c1
Sequence:CCGGCGGTATCTCTTAGTTCATGTACTCGAGTACATGAACTAAGAGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1108s1c1
Sequence:CCGGCCAGCATTTCAGTGACAGCTACTCGAGTAGCTGTCACTGAAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-596s1c1
Sequence:CCGGCAAGGCATGTAATTTGATGATCTCGAGATCATCAAATTACATGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1239s1c1
Sequence:CCGGGCAGCTTTGACTAACACCTTTCTCGAGAAAGGTGTTAGTCAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1595s1c1
Sequence:CCGGCGGGATCTATGTTGACATCTACTCGAGTAGATGTCAACATAGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026345
MANSC1 MISSION shRNA shRNA Plasmid DNA
MANSC domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026345.2-1626s1c1
Sequence:CCGGCGGTATCTCTTAGTTCATGTACTCGAGTACATGAACTAAGAGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1108s1c1
Sequence:CCGGCCAGCATTTCAGTGACAGCTACTCGAGTAGCTGTCACTGAAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-596s1c1
Sequence:CCGGCAAGGCATGTAATTTGATGATCTCGAGATCATCAAATTACATGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1239s1c1
Sequence:CCGGGCAGCTTTGACTAACACCTTTCTCGAGAAAGGTGTTAGTCAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1595s1c1
Sequence:CCGGCGGGATCTATGTTGACATCTACTCGAGTAGATGTCAACATAGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026345
MANSC1 MISSION shRNA Lentiviral Transduction Particles
MANSC domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026345.2-1626s1c1
Sequence:CCGGCGGTATCTCTTAGTTCATGTACTCGAGTACATGAACTAAGAGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1108s1c1
Sequence:CCGGCCAGCATTTCAGTGACAGCTACTCGAGTAGCTGTCACTGAAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-596s1c1
Sequence:CCGGCAAGGCATGTAATTTGATGATCTCGAGATCATCAAATTACATGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1239s1c1
Sequence:CCGGGCAGCTTTGACTAACACCTTTCTCGAGAAAGGTGTTAGTCAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026345.2-1595s1c1
Sequence:CCGGCGGGATCTATGTTGACATCTACTCGAGTAGATGTCAACATAGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)