EMAIL THIS PAGE TO A FRIEND

MANSC4

MANSC domain containing 4

32 Gene Product Result for
UniProtKB ID: A6NHS7
Gene ID:
Mouse(545893) MANSC domain containing 4
Rat(691362) MANSC domain containing 4
chicken(419047) MANSC domain containing 4
dog(100684418) MANSC domain containing 4
cow(100297600) MANSC domain containing 4
domestic cat(101085298) MANSC domain containing 4
naked mole-rat(101714310) MANSC domain containing 4
domestic guinea pig(100728599) MANSC domain containing 4
sheep(101111272) MANSC domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184561 MISSION® esiRNA esiRNA targeting mouse Gm5887 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001077890 Rosetta Predictions rat pricing
NM_001034903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358898 predicted 277
2 SASI_Rn02_00358899 predicted 309
3 SASI_Rn02_00358900 predicted 268
4 SASI_Rn02_00358901 predicted 272
5 SASI_Rn02_00358902 predicted 243
6 SASI_Rn02_00358903 predicted 404
7 SASI_Rn02_00358904 predicted 273
8 SASI_Rn02_00358905 predicted 378
9 SASI_Rn02_00358906 predicted 388
10 SASI_Rn02_00358907 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091484 predicted 283
2 SASI_Mm01_00091485 predicted 697
3 SASI_Mm01_00091486 predicted 613
4 SASI_Mm01_00091487 predicted 274
5 SASI_Mm01_00091488 predicted 693
6 SASI_Mm01_00091489 predicted 233
7 SASI_Mm01_00091490 predicted 799
8 SASI_Mm01_00091491 predicted 623
9 SASI_Mm01_00091492 predicted 623
10 SASI_Mm01_00091493 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034903
MANSC4 MISSION shRNA Bacterial Glycerol Stock
MANSC domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-497s21c1
Sequence:CCGGGGATAGACTGCGGATTCTAAACTCGAGTTTAGAATCCGCAGTCTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-663s21c1
Sequence:CCGGTTAAGATTCACATCTGCAAACCTCGAGGTTTGCAGATGTGAATCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-592s21c1
Sequence:CCGGCAACCACACAGCAGGATTTAGCTCGAGCTAAATCCTGCTGTGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-528s21c1
Sequence:CCGGGTAGGGAGTGAAGGAGTATACCTCGAGGTATACTCCTTCACTCCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-615s21c1
Sequence:CCGGGCAAACACGGGTATCAGTTATCTCGAGATAACTGATACCCGTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034903
MANSC4 MISSION shRNA shRNA Plasmid DNA
MANSC domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-497s21c1
Sequence:CCGGGGATAGACTGCGGATTCTAAACTCGAGTTTAGAATCCGCAGTCTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-663s21c1
Sequence:CCGGTTAAGATTCACATCTGCAAACCTCGAGGTTTGCAGATGTGAATCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-592s21c1
Sequence:CCGGCAACCACACAGCAGGATTTAGCTCGAGCTAAATCCTGCTGTGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-528s21c1
Sequence:CCGGGTAGGGAGTGAAGGAGTATACCTCGAGGTATACTCCTTCACTCCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-615s21c1
Sequence:CCGGGCAAACACGGGTATCAGTTATCTCGAGATAACTGATACCCGTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034903
MANSC4 MISSION shRNA Lentiviral Transduction Particles
MANSC domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-497s21c1
Sequence:CCGGGGATAGACTGCGGATTCTAAACTCGAGTTTAGAATCCGCAGTCTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-663s21c1
Sequence:CCGGTTAAGATTCACATCTGCAAACCTCGAGGTTTGCAGATGTGAATCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-592s21c1
Sequence:CCGGCAACCACACAGCAGGATTTAGCTCGAGCTAAATCCTGCTGTGTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-528s21c1
Sequence:CCGGGTAGGGAGTGAAGGAGTATACCTCGAGGTATACTCCTTCACTCCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034903.3-615s21c1
Sequence:CCGGGCAAACACGGGTATCAGTTATCTCGAGATAACTGATACCCGTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)