EMAIL THIS PAGE TO A FRIEND

MAOA

monoamine oxidase A

183 Gene Product Result for
Synonyms: MAO-A
UniProtKB ID: P21397, B4DF46, Q16426
Gene ID:
Human(4128) Summary: This gene is one of two neighboring gene family members that encode mitochondrial enzymes which catalyze the oxidative deamination of amines, such as dopamine, norepinephrine, and serotonin. Mutation of this gene results in Brunner syndrome. This gene has also been associated with a variety of other psychiatric disorders, including antisocial behavior. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]
Mouse(17161) monoamine oxidase A
Rat(29253) monoamine oxidase A
chicken(418563) monoamine oxidase A
domestic cat(101091848) monoamine oxidase A
Horse(100033867) monoamine oxidase A
cow(281293) monoamine oxidase A
dog(403450) monoamine oxidase A
sheep(101106401) monoamine oxidase A
domestic guinea pig(100714848) monoamine oxidase A
naked mole-rat(101725537) monoamine oxidase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M1818 Molindone hydrochloride ≥98% (HPLC), solid human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
445347 (R)-(−)-1-Aminoindane 97% human pricing
445355 (S)-(+)-1-Aminoindan 97% human pricing
H1753 Hydralazine hydrochloride human pricing
P6777 Phenelzine sulfate salt human pricing
Q3251 Quinacrine dihydrochloride ≥90% human pricing
P8511 trans-2-Phenylcyclopropylamine hydrochloride human pricing
D2016 Biochanin A human, mouse pricing
D7802 Daidzein ≥98%, synthetic human, mouse, rat pricing
51330 Harmaline ≥95% human, rat pricing
M3778 N-Methyl-N-propargyl-3-(2,4-dichlorophenoxy)propylamine hydrochloride ≥97% (GC) human, rat pricing
P5555 Puerarin analytical standard mouse pricing
82435 Puerarin ≥98.0% (HPLC) mouse pricing
H23805 4-Hydroxycoumarin 98% mouse, rat pricing
254886 6,7-Dimethoxycoumarin 98% mouse, rat pricing
576468 7-Hydroxy-4-phenylcoumarin 97% mouse, rat pricing
419753 7-Hydroxyflavanone 98% mouse, rat pricing
30408 Daidzin ≥95.0% (HPLC) mouse, rat pricing
75375 Ononin ≥99.0% (TLC) mouse, rat pricing
B5057 7-Benzyloxy-4-trifluoromethylcoumarin ≥99% (HPLC), solid rat pricing
M3501 8-Methoxypsoralen analytical standard rat pricing
C4261 Coumarin ≥99% (HPLC) rat pricing
179523 Dimethyl suberimidate dihydrochloride 98% rat pricing
74835 Dimethyl suberimidate dihydrochloride ≥98.0% (AT) rat pricing
W274607 Dimethyl sulfide ≥99%, FCC rat pricing
274380 Dimethyl sulfide anhydrous, ≥99.0% rat pricing
471577 Dimethyl sulfide ≥99% rat pricing
W274623 Dimethyl sulfide natural, ≥99%, FCC, FG rat pricing
41625 Dimethyl sulfide ≥95.0% (GC) rat pricing
W274615 Dimethyl sulfide redistilled, ≥99%, FCC, FG rat pricing
610240 DL-Amphetamine solution 1 mg/mL in methanol, drug standard rat pricing
150223 N-Methylpropargylamine 95% rat pricing
218820 Phenoxathiin 97% rat pricing
T34002 Thioxanthen-9-one 97% rat pricing
89110 Thioxanthone purum, ≥97.0% (HPLC) rat pricing

Kits

Product # Description Species Add to Cart
 
MAK136 Monoamine Oxidase Activity Assay Kit sufficient for 100 fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000240 Rosetta Predictions human pricing
XM_001058993 Rosetta Predictions rat pricing
XM_343764 Rosetta Predictions rat pricing
NM_173740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199754 predicted 278
2 SASI_Hs02_00302156 predicted 275
3 SASI_Hs01_00199756 predicted 405
4 SASI_Hs01_00199757 predicted 258
5 SASI_Hs01_00199758 predicted 922
6 SASI_Hs01_00199759 predicted 936
7 SASI_Hs01_00199760 predicted 345
8 SASI_Hs01_00199761 predicted 1759
9 SASI_Hs01_00199762 predicted 1575
10 SASI_Hs01_00199763 predicted 1492
11 SASI_Hs01_00199755 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291544 predicted 2494
2 SASI_Rn02_00291545 predicted 1244
3 SASI_Rn02_00291546 predicted 1556
4 SASI_Rn02_00291547 predicted 1881
5 SASI_Rn02_00291548 predicted 2051
6 SASI_Rn02_00291549 predicted 374
7 SASI_Rn02_00291550 predicted 2749
8 SASI_Rn02_00291551 predicted 2741
9 SASI_Rn02_00291552 predicted 1997
10 SASI_Rn02_00291553 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396249 predicted 2497
2 SASI_Rn02_00396250 predicted 1245
3 SASI_Rn02_00396251 predicted 1564
4 SASI_Rn02_00396252 predicted 1880
5 SASI_Rn02_00396253 predicted 2049
6 SASI_Rn02_00396254 predicted 378
7 SASI_Rn02_00396255 predicted 2751
8 SASI_Rn02_00396256 predicted 2736
9 SASI_Rn02_00396257 predicted 1995
10 SASI_Rn02_00396258 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345384 predicted 1295
2 SASI_Mm01_00187348 predicted 524
3 SASI_Mm01_00187349 predicted 1573
4 SASI_Mm01_00187350 predicted 1050
5 SASI_Mm01_00187351 predicted 294
6 SASI_Mm01_00187353 predicted 926
7 SASI_Mm02_00345385 predicted 613
8 SASI_Mm01_00187355 predicted 1777
9 SASI_Mm01_00187356 predicted 412
10 SASI_Mm01_00187357 predicted 1515
11 SASI_Mm01_00187352 predicted 373
12 SASI_Mm01_00187354 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173740
VALIDATED
MAOA MISSION shRNA Bacterial Glycerol Stock
monoamine oxidase A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.3-362s21c1
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-760s21c1
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173740.2-1843s21c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-629s1c2
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-232s1c2
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-1605s21c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-358s21c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173740.1-1712s1c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173740.1-1474s1c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-227s1c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173740
VALIDATED
MAOA MISSION shRNA shRNA Plasmid DNA
monoamine oxidase A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.3-362s21c1
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-760s21c1
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173740.2-1843s21c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-629s1c2
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-232s1c2
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-1605s21c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-358s21c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173740.1-1712s1c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173740.1-1474s1c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-227s1c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173740
VALIDATED
MAOA MISSION shRNA Lentiviral Transduction Particles
monoamine oxidase A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.3-362s21c1
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-760s21c1
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173740.2-1843s21c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-629s1c2
Sequence:CCGGCGGATATTCTCAGTCACCAATCTCGAGATTGGTGACTGAGAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-232s1c2
Sequence:CCGGCCAGAACAGAATCTTACGCTTCTCGAGAAGCGTAAGATTCTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-1605s21c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173740.2-358s21c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173740.1-1712s1c1
Sequence:CCGGGCTCAGTTTAATTTCAGTCTTCTCGAGAAGACTGAAATTAAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173740.1-1474s1c1
Sequence:CCGGCCACACCTTCTTAGAGAGGAACTCGAGTTCCTCTCTAAGAAGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173740.1-227s1c1
Sequence:CCGGCCAACCCAGAACAGAATCTTACTCGAGTAAGATTCTGTTCTGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000240
MAOA MISSION shRNA Bacterial Glycerol Stock
monoamine oxidase A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-461s21c1
Sequence:CCGGAGTGAGCGTCTCGTTCAATATCTCGAGATATTGAACGAGACGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1045s21c1
Sequence:CCGGAGCAGAGAGAAACCAGTTAATCTCGAGATTAACTGGTTTCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000240.2-3315s21c1
Sequence:CCGGATAAGGAGTTGCCGCATATTACTCGAGTAATATGCGGCAACTCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1543s21c1
Sequence:CCGGAGCAGCTAGGGAGGTCTTAAACTCGAGTTTAAGACCTCCCTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-972s21c1
Sequence:CCGGATGAGTGCAAATACGTAATTACTCGAGTAATTACGTATTTGCACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1046s1c1
Sequence:CCGGGCAGAGAGAAACCAGTTAATTCTCGAGAATTAACTGGTTTCTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-925s1c1
Sequence:CCGGCCAGTCAAGTGACAACATCATCTCGAGATGATGTTGTCACTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1680s1c1
Sequence:CCGGGCCTGCTGAAGATCATTGGATCTCGAGATCCAATGATCTTCAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-797s1c1
Sequence:CCGGCGGATATTCTCTGTCACCAATCTCGAGATTGGTGACAGAGAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000240
MAOA MISSION shRNA shRNA Plasmid DNA
monoamine oxidase A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-461s21c1
Sequence:CCGGAGTGAGCGTCTCGTTCAATATCTCGAGATATTGAACGAGACGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1045s21c1
Sequence:CCGGAGCAGAGAGAAACCAGTTAATCTCGAGATTAACTGGTTTCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000240.2-3315s21c1
Sequence:CCGGATAAGGAGTTGCCGCATATTACTCGAGTAATATGCGGCAACTCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1543s21c1
Sequence:CCGGAGCAGCTAGGGAGGTCTTAAACTCGAGTTTAAGACCTCCCTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-972s21c1
Sequence:CCGGATGAGTGCAAATACGTAATTACTCGAGTAATTACGTATTTGCACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1046s1c1
Sequence:CCGGGCAGAGAGAAACCAGTTAATTCTCGAGAATTAACTGGTTTCTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-925s1c1
Sequence:CCGGCCAGTCAAGTGACAACATCATCTCGAGATGATGTTGTCACTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1680s1c1
Sequence:CCGGGCCTGCTGAAGATCATTGGATCTCGAGATCCAATGATCTTCAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-797s1c1
Sequence:CCGGCGGATATTCTCTGTCACCAATCTCGAGATTGGTGACAGAGAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000240
MAOA MISSION shRNA Lentiviral Transduction Particles
monoamine oxidase A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-461s21c1
Sequence:CCGGAGTGAGCGTCTCGTTCAATATCTCGAGATATTGAACGAGACGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1045s21c1
Sequence:CCGGAGCAGAGAGAAACCAGTTAATCTCGAGATTAACTGGTTTCTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000240.2-3315s21c1
Sequence:CCGGATAAGGAGTTGCCGCATATTACTCGAGTAATATGCGGCAACTCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-1543s21c1
Sequence:CCGGAGCAGCTAGGGAGGTCTTAAACTCGAGTTTAAGACCTCCCTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000240.2-972s21c1
Sequence:CCGGATGAGTGCAAATACGTAATTACTCGAGTAATTACGTATTTGCACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1046s1c1
Sequence:CCGGGCAGAGAGAAACCAGTTAATTCTCGAGAATTAACTGGTTTCTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-925s1c1
Sequence:CCGGCCAGTCAAGTGACAACATCATCTCGAGATGATGTTGTCACTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-1680s1c1
Sequence:CCGGGCCTGCTGAAGATCATTGGATCTCGAGATCCAATGATCTTCAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000240.2-797s1c1
Sequence:CCGGCGGATATTCTCTGTCACCAATCTCGAGATTGGTGACAGAGAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)