EMAIL THIS PAGE TO A FRIEND

MAOB

monoamine oxidase B

112 Gene Product Result for
UniProtKB ID: P27338, B2R6R3, D3DWC3, Q7Z6S2
Gene ID:
Human(4129) Summary: The protein encoded by this gene belongs to the flavin monoamine oxidase family. It is a enzyme located in the mitochondrial outer membrane. It catalyzes the oxidative deamination of biogenic and xenobiotic amines and plays an important role in the metabolism of neuroactive and vasoactive amines in the central nervous sysytem and peripheral tissues. This protein preferentially degrades benzylamine and phenylethylamine. [provided by RefSeq, Jul 2008]
Mouse(109731) monoamine oxidase B
Rat(25750) monoamine oxidase B
naked mole-rat(101724899) monoamine oxidase B
domestic guinea pig(100135573) monoamine oxidase B
sheep(101106659) monoamine oxidase B
chicken(418561) monoamine oxidase B
cow(338445) monoamine oxidase B
domestic cat(101092086) monoamine oxidase B
Horse(100033868) monoamine oxidase B
dog(403451) monoamine oxidase B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M1818 Molindone hydrochloride ≥98% (HPLC), solid human pricing
C197 8-(3-Chlorostyryl)caffeine ≥98% (HPLC), solid human, mouse, rat pricing

Kits

Product # Description Species Add to Cart
 
MAK136 Monoamine Oxidase Activity Assay Kit sufficient for 100 fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000898 Rosetta Predictions human pricing
NM_013198 Rosetta Predictions rat pricing
NM_172778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053359 predicted 919
2 SASI_Hs01_00053360 predicted 1543
3 SASI_Hs01_00053361 predicted 404
4 SASI_Hs01_00053362 predicted 495
5 SASI_Hs01_00053363 predicted 1174
6 SASI_Hs02_00303461 predicted 874
7 SASI_Hs02_00303462 predicted 366
8 SASI_Hs01_00053364 predicted 1261
9 SASI_Hs01_00053366 predicted 940
10 SASI_Hs01_00053367 predicted 371
11 SASI_Hs01_00053358 predicted 1478
12 SASI_Hs01_00053365 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101544 predicted 1710
2 SASI_Rn01_00101545 predicted 288
3 SASI_Rn01_00101547 predicted 1067
4 SASI_Rn01_00101549 predicted 1624
5 SASI_Rn02_00261069 predicted 1430
6 SASI_Rn01_00101550 predicted 1161
7 SASI_Rn01_00101551 predicted 807
8 SASI_Rn01_00101552 predicted 497
9 SASI_Rn01_00101553 predicted 808
10 SASI_Rn02_00261070 predicted 826
11 SASI_Rn01_00101546 predicted 296
12 SASI_Rn01_00101548 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152465 predicted 385
2 SASI_Mm01_00152466 predicted 1171
3 SASI_Mm01_00152467 predicted 836
4 SASI_Mm01_00152468 predicted 307
5 SASI_Mm01_00152469 predicted 1046
6 SASI_Mm01_00152470 predicted 669
7 SASI_Mm01_00152471 predicted 835
8 SASI_Mm01_00152472 predicted 1096
9 SASI_Mm01_00152473 predicted 849
10 SASI_Mm02_00344672 predicted 831
11 SASI_Mm01_00152464 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000898
MAOB MISSION shRNA Bacterial Glycerol Stock
monoamine oxidase B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1384s1c1
Sequence:CCGGGCCAGTGGACAGGATTTACTTCTCGAGAAGTAAATCCTGTCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1621s1c1
Sequence:CCGGGATTGGATTGACCACCATCTTCTCGAGAAGATGGTGGTCAATCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-461s1c1
Sequence:CCGGCCAATTACCTACTTAGATCATCTCGAGATGATCTAAGTAGGTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-327s1c1
Sequence:CCGGCCCAGAATCGTATCTTGAGATCTCGAGATCTCAAGATACGATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-889s1c1
Sequence:CCGGCCATGAGATGTATGAGGCTAACTCGAGTTAGCCTCATACATCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-909s21c1
Sequence:CCGGGTCCTTGTGGAGACCCTAAACCTCGAGGTTTAGGGTCTCCACAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-434s21c1
Sequence:CCGGGCGTCTGATCCACCATGTAAACTCGAGTTTACATGGTGGATCAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-504s21c1
Sequence:CCGGATTACCTACTTAGATCATAACCTCGAGGTTATGATCTAAGTAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-400s21c1
Sequence:CCGGTAGGATTGGAGACCTACAAAGCTCGAGCTTTGTAGGTCTCCAATCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000898
MAOB MISSION shRNA shRNA Plasmid DNA
monoamine oxidase B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1384s1c1
Sequence:CCGGGCCAGTGGACAGGATTTACTTCTCGAGAAGTAAATCCTGTCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1621s1c1
Sequence:CCGGGATTGGATTGACCACCATCTTCTCGAGAAGATGGTGGTCAATCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-461s1c1
Sequence:CCGGCCAATTACCTACTTAGATCATCTCGAGATGATCTAAGTAGGTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-327s1c1
Sequence:CCGGCCCAGAATCGTATCTTGAGATCTCGAGATCTCAAGATACGATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-889s1c1
Sequence:CCGGCCATGAGATGTATGAGGCTAACTCGAGTTAGCCTCATACATCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-909s21c1
Sequence:CCGGGTCCTTGTGGAGACCCTAAACCTCGAGGTTTAGGGTCTCCACAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-434s21c1
Sequence:CCGGGCGTCTGATCCACCATGTAAACTCGAGTTTACATGGTGGATCAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-504s21c1
Sequence:CCGGATTACCTACTTAGATCATAACCTCGAGGTTATGATCTAAGTAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-400s21c1
Sequence:CCGGTAGGATTGGAGACCTACAAAGCTCGAGCTTTGTAGGTCTCCAATCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000898
MAOB MISSION shRNA Lentiviral Transduction Particles
monoamine oxidase B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1384s1c1
Sequence:CCGGGCCAGTGGACAGGATTTACTTCTCGAGAAGTAAATCCTGTCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-1621s1c1
Sequence:CCGGGATTGGATTGACCACCATCTTCTCGAGAAGATGGTGGTCAATCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-461s1c1
Sequence:CCGGCCAATTACCTACTTAGATCATCTCGAGATGATCTAAGTAGGTAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-327s1c1
Sequence:CCGGCCCAGAATCGTATCTTGAGATCTCGAGATCTCAAGATACGATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000898.3-889s1c1
Sequence:CCGGCCATGAGATGTATGAGGCTAACTCGAGTTAGCCTCATACATCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-909s21c1
Sequence:CCGGGTCCTTGTGGAGACCCTAAACCTCGAGGTTTAGGGTCTCCACAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-434s21c1
Sequence:CCGGGCGTCTGATCCACCATGTAAACTCGAGTTTACATGGTGGATCAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-504s21c1
Sequence:CCGGATTACCTACTTAGATCATAACCTCGAGGTTATGATCTAAGTAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000898.4-400s21c1
Sequence:CCGGTAGGATTGGAGACCTACAAAGCTCGAGCTTTGTAGGTCTCCAATCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172778
MAOB MISSION shRNA Bacterial Glycerol Stock
monoamine oxidase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-1122s1c1
Sequence:CCGGCCTTGCTCACAAAGCTAGAAACTCGAGTTTCTAGCTTTGTGAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-348s1c1
Sequence:CCGGGCGGCTGATACACTTTGTAAACTCGAGTTTACAAAGTGTATCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-282s1c1
Sequence:CCGGCCAGAATCGTATCTTACGATTCTCGAGAATCGTAAGATACGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172778.1-1769s1c1
Sequence:CCGGCCCAGTAATTTGTTCTCCATTCTCGAGAATGGAGAACAAATTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-281s1c1
Sequence:CCGGCCCAGAATCGTATCTTACGATCTCGAGATCGTAAGATACGATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172778
MAOB MISSION shRNA shRNA Plasmid DNA
monoamine oxidase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-1122s1c1
Sequence:CCGGCCTTGCTCACAAAGCTAGAAACTCGAGTTTCTAGCTTTGTGAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-348s1c1
Sequence:CCGGGCGGCTGATACACTTTGTAAACTCGAGTTTACAAAGTGTATCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-282s1c1
Sequence:CCGGCCAGAATCGTATCTTACGATTCTCGAGAATCGTAAGATACGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172778.1-1769s1c1
Sequence:CCGGCCCAGTAATTTGTTCTCCATTCTCGAGAATGGAGAACAAATTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-281s1c1
Sequence:CCGGCCCAGAATCGTATCTTACGATCTCGAGATCGTAAGATACGATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172778
MAOB MISSION shRNA Lentiviral Transduction Particles
monoamine oxidase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-1122s1c1
Sequence:CCGGCCTTGCTCACAAAGCTAGAAACTCGAGTTTCTAGCTTTGTGAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-348s1c1
Sequence:CCGGGCGGCTGATACACTTTGTAAACTCGAGTTTACAAAGTGTATCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-282s1c1
Sequence:CCGGCCAGAATCGTATCTTACGATTCTCGAGAATCGTAAGATACGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172778.1-1769s1c1
Sequence:CCGGCCCAGTAATTTGTTCTCCATTCTCGAGAATGGAGAACAAATTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172778.1-281s1c1
Sequence:CCGGCCCAGAATCGTATCTTACGATCTCGAGATCGTAAGATACGATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)