EMAIL THIS PAGE TO A FRIEND

MAP1A

microtubule-associated protein 1A

153 Gene Product Result for
Synonyms: MAP1L MTAP1A
UniProtKB ID: P78559, O95643, Q12973, Q15882, Q9UJT4
Gene ID:
Human(4130) Summary: This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
Mouse(17754) microtubule-associated protein 1 A
Rat(25152) microtubule-associated protein 1A
Thale Cress(819132) methionine aminopeptidase 1A
chicken(415588) microtubule-associated protein 1A
domestic cat(101098637) microtubule-associated protein 1A
cow(515593) microtubule-associated protein 1A
dog(478275) microtubule-associated protein 1A
naked mole-rat(101722146) microtubule-associated protein 1A
Domestic Rabbit(100328681) microtubule-associated protein 1A
domestic guinea pig(100724871) microtubule-associated protein 1A
sheep(101110454) microtubule-associated protein 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_194040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002373 Rosetta Predictions human pricing
NM_030995 Rosetta Predictions rat pricing
NM_032393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127175 predicted 2857
2 SASI_Hs02_00333710 predicted 4406
3 SASI_Hs01_00127177 predicted 4846
4 SASI_Hs02_00333711 predicted 6343
5 SASI_Hs01_00127180 predicted 5545
6 SASI_Hs01_00127181 predicted 2679
7 SASI_Hs01_00127182 predicted 4659
8 SASI_Hs01_00127183 predicted 2935
9 SASI_Hs01_00127184 predicted 4487
10 SASI_Hs02_00333712 predicted 5102
11 SASI_Hs01_00127176 predicted 3620
12 SASI_Hs01_00127178 predicted 3864
13 SASI_Hs01_00127179 predicted 2133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264165 predicted 4313
2 SASI_Rn01_00071238 predicted 2506
3 SASI_Rn02_00264166 predicted 3717
4 SASI_Rn01_00071241 predicted 5414
5 SASI_Rn01_00071243 predicted 3965
6 SASI_Rn02_00264167 predicted 4801
7 SASI_Rn01_00071245 predicted 8622
8 SASI_Rn01_00071246 predicted 2652
9 SASI_Rn02_00264168 predicted 3291
10 SASI_Rn02_00264169 predicted 1220
11 SASI_Rn01_00071239 predicted 3824
12 SASI_Rn01_00071240 predicted 3400
13 SASI_Rn01_00071242 predicted 2997
14 SASI_Rn01_00071244 predicted 6586
15 SASI_Rn01_00071247 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337227 predicted 3595
2 SASI_Mm02_00337228 predicted 2527
3 SASI_Mm02_00337229 predicted 8922
4 SASI_Mm02_00337230 predicted 292
5 SASI_Mm02_00337231 predicted 5457
6 SASI_Mm02_00337232 predicted 4632
7 SASI_Mm02_00337233 predicted 7503
8 SASI_Mm02_00337234 predicted 1016
9 SASI_Mm02_00337235 predicted 275
10 SASI_Mm02_00337236 predicted 2786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002373
MAP1A MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-7069s1c1
Sequence:CCGGCGGCATGATGAATACCTGGAACTCGAGTTCCAGGTATTCATCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-5458s1c1
Sequence:CCGGCCTGAGCAGGACAATAGGTATCTCGAGATACCTATTGTCCTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002373.4-9119s1c1
Sequence:CCGGGCACTGTCAAATGCTGGTATTCTCGAGAATACCAGCATTTGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2822s1c1
Sequence:CCGGCCTCTGGCAAAGTCTATGGAACTCGAGTTCCATAGACTTTGCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2935s1c1
Sequence:CCGGTGTGACAAACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTTTGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002373
MAP1A MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-7069s1c1
Sequence:CCGGCGGCATGATGAATACCTGGAACTCGAGTTCCAGGTATTCATCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-5458s1c1
Sequence:CCGGCCTGAGCAGGACAATAGGTATCTCGAGATACCTATTGTCCTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002373.4-9119s1c1
Sequence:CCGGGCACTGTCAAATGCTGGTATTCTCGAGAATACCAGCATTTGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2822s1c1
Sequence:CCGGCCTCTGGCAAAGTCTATGGAACTCGAGTTCCATAGACTTTGCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2935s1c1
Sequence:CCGGTGTGACAAACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTTTGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002373
MAP1A MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-7069s1c1
Sequence:CCGGCGGCATGATGAATACCTGGAACTCGAGTTCCAGGTATTCATCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-5458s1c1
Sequence:CCGGCCTGAGCAGGACAATAGGTATCTCGAGATACCTATTGTCCTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002373.4-9119s1c1
Sequence:CCGGGCACTGTCAAATGCTGGTATTCTCGAGAATACCAGCATTTGACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2822s1c1
Sequence:CCGGCCTCTGGCAAAGTCTATGGAACTCGAGTTCCATAGACTTTGCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002373.4-2935s1c1
Sequence:CCGGTGTGACAAACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTTTGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194040
MAP1A MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-156s1c1
Sequence:CCGGGCGGAAATACTCCTTGCTCATCTCGAGATGAGCAAGGAGTATTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194040.5-7746s1c1
Sequence:CCGGCCAGGAGAAACCAGCCTTAATCTCGAGATTAAGGCTGGTTTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-996s1c1
Sequence:CCGGCGAGACCATCATCCTAGTCAACTCGAGTTGACTAGGATGATGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-7086s1c1
Sequence:CCGGCCGCAATAAGTCTGCAGAGAACTCGAGTTCTCTGCAGACTTATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-2251s1c1
Sequence:CCGGGCCAACTTGAAACCCAGCAAACTCGAGTTTGCTGGGTTTCAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194040
MAP1A MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-156s1c1
Sequence:CCGGGCGGAAATACTCCTTGCTCATCTCGAGATGAGCAAGGAGTATTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194040.5-7746s1c1
Sequence:CCGGCCAGGAGAAACCAGCCTTAATCTCGAGATTAAGGCTGGTTTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-996s1c1
Sequence:CCGGCGAGACCATCATCCTAGTCAACTCGAGTTGACTAGGATGATGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-7086s1c1
Sequence:CCGGCCGCAATAAGTCTGCAGAGAACTCGAGTTCTCTGCAGACTTATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-2251s1c1
Sequence:CCGGGCCAACTTGAAACCCAGCAAACTCGAGTTTGCTGGGTTTCAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194040
MAP1A MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-156s1c1
Sequence:CCGGGCGGAAATACTCCTTGCTCATCTCGAGATGAGCAAGGAGTATTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_194040.5-7746s1c1
Sequence:CCGGCCAGGAGAAACCAGCCTTAATCTCGAGATTAAGGCTGGTTTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-996s1c1
Sequence:CCGGCGAGACCATCATCCTAGTCAACTCGAGTTGACTAGGATGATGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-7086s1c1
Sequence:CCGGCCGCAATAAGTCTGCAGAGAACTCGAGTTCTCTGCAGACTTATTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194040.5-2251s1c1
Sequence:CCGGGCCAACTTGAAACCCAGCAAACTCGAGTTTGCTGGGTTTCAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)