EMAIL THIS PAGE TO A FRIEND

MAP1B

microtubule-associated protein 1B

168 Gene Product Result for
Synonyms: FUTSCH MAP5
UniProtKB ID: P46821, A2BDK5
Gene ID:
Human(4131) Summary: This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
Mouse(17755) microtubule-associated protein 1B
Rat(29456) microtubule-associated protein 1B
Zebrafish(559032) microtubule-associated protein 1B
cow(514739) microtubule-associated protein 1B
domestic cat(101095713) microtubule-associated protein 1B
dog(478092) microtubule-associated protein 1B
chicken(396174) microtubule-associated protein 1B
Thale Cress(822165) methionine aminopeptidase 1C
sheep(101116509) microtubule-associated protein 1B
domestic guinea pig(100735781) microtubule-associated protein 1B
naked mole-rat(101710832) microtubule-associated protein 1B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005909 Rosetta Predictions human pricing
NM_032010 Rosetta Predictions human pricing
NM_019217 Rosetta Predictions rat pricing
NM_008634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196130 predicted 5762
2 SASI_Hs01_00196131 predicted 7252
3 SASI_Hs01_00196132 predicted 3724
4 SASI_Hs01_00196133 predicted 5211
5 SASI_Hs01_00196135 predicted 7329
6 SASI_Hs02_00340522 predicted 638
7 SASI_Hs01_00196136 predicted 3774
8 SASI_Hs02_00340523 predicted 787
9 SASI_Hs02_00340524 predicted 5891
10 SASI_Hs01_00196137 predicted 4824
11 SASI_Hs01_00196134 predicted 7055
12 SASI_Hs01_00196138 predicted 3521
13 SASI_Hs01_00196139 predicted 5914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105664 predicted 5492
2 SASI_Hs01_00105665 predicted 6983
3 SASI_Hs01_00105666 predicted 3457
4 SASI_Hs01_00105667 predicted 4946
5 SASI_Hs01_00105668 predicted 6795
6 SASI_Hs01_00105669 predicted 7060
7 SASI_Hs01_00105670 predicted 3510
8 SASI_Hs01_00105671 predicted 4546
9 SASI_Hs01_00105672 predicted 3267
10 SASI_Hs01_00105673 predicted 5665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262060 predicted 4529
2 SASI_Rn02_00262061 predicted 4686
3 SASI_Rn02_00262062 predicted 4759
4 SASI_Rn02_00262063 predicted 6004
5 SASI_Rn02_00262064 predicted 2795
6 SASI_Rn02_00262065 predicted 1007
7 SASI_Rn02_00262066 predicted 5412
8 SASI_Rn02_00262067 predicted 4702
9 SASI_Rn02_00262068 predicted 474
10 SASI_Rn02_00262069 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156734 predicted 1698
2 SASI_Mm01_00156735 predicted 3571
3 SASI_Mm01_00156736 predicted 5222
4 SASI_Mm01_00156737 predicted 606
5 SASI_Mm01_00156738 predicted 1755
6 SASI_Mm01_00156739 predicted 1371
7 SASI_Mm01_00156740 predicted 1059
8 SASI_Mm01_00156741 predicted 4987
9 SASI_Mm01_00156742 predicted 4106
10 SASI_Mm02_00314354 predicted 5962
11 SASI_Mm01_00156743 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032010
VALIDATED
MAP1B MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-6794s1c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-5233s1c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-1020s1c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032010.1-8256s1c1
Sequence:CCGGCCCAATTAACTGAAGCAAATACTCGAGTATTTGCTTCAGTTAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-918s1c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032010
VALIDATED
MAP1B MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-6794s1c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-5233s1c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-1020s1c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032010.1-8256s1c1
Sequence:CCGGCCCAATTAACTGAAGCAAATACTCGAGTATTTGCTTCAGTTAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-918s1c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032010
VALIDATED
MAP1B MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-6794s1c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-5233s1c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-1020s1c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032010.1-8256s1c1
Sequence:CCGGCCCAATTAACTGAAGCAAATACTCGAGTATTTGCTTCAGTTAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032010.1-918s1c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008634
VALIDATED
MAP1B MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008634.2-4487s21c1
Sequence:CCGGACGGGCTTCATACCCATAAAGCTCGAGCTTTATGGGTATGAAGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008634.1-7649s1c1
Sequence:CCGGCCCACAATAGATTTCGAGTTACTCGAGTAACTCGAAATCTATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-3753s1c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-5307s1c1
Sequence:CCGGCCCAGAGAGATGTCCTTATATCTCGAGATATAAGGACATCTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-887s1c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-2012s1c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-949s21c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-2074s21c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-7587s21c1
Sequence:CCGGACGTCCATTCATCCAATTAAGCTCGAGCTTAATTGGATGAATGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-3815s21c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008634
VALIDATED
MAP1B MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008634.2-4487s21c1
Sequence:CCGGACGGGCTTCATACCCATAAAGCTCGAGCTTTATGGGTATGAAGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008634.1-7649s1c1
Sequence:CCGGCCCACAATAGATTTCGAGTTACTCGAGTAACTCGAAATCTATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-3753s1c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-5307s1c1
Sequence:CCGGCCCAGAGAGATGTCCTTATATCTCGAGATATAAGGACATCTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-887s1c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-2012s1c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-949s21c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-2074s21c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-7587s21c1
Sequence:CCGGACGTCCATTCATCCAATTAAGCTCGAGCTTAATTGGATGAATGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-3815s21c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008634
VALIDATED
MAP1B MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008634.2-4487s21c1
Sequence:CCGGACGGGCTTCATACCCATAAAGCTCGAGCTTTATGGGTATGAAGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008634.1-7649s1c1
Sequence:CCGGCCCACAATAGATTTCGAGTTACTCGAGTAACTCGAAATCTATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-3753s1c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-5307s1c1
Sequence:CCGGCCCAGAGAGATGTCCTTATATCTCGAGATATAAGGACATCTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-887s1c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008634.1-2012s1c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-949s21c1
Sequence:CCGGCGGATTCAACATGCTCATCAACTCGAGTTGATGAGCATGTTGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-2074s21c1
Sequence:CCGGGCCCAAGAAAGAAGTGGTTAACTCGAGTTAACCACTTCTTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-7587s21c1
Sequence:CCGGACGTCCATTCATCCAATTAAGCTCGAGCTTAATTGGATGAATGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008634.2-3815s21c1
Sequence:CCGGGCCGAGTTAGACATCAAAGATCTCGAGATCTTTGATGTCTAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005909
VALIDATED
MAP1B MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7068s21c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7785s21c1
Sequence:CCGGGGTGATGCAAGTCACTAAATTCTCGAGAATTTAGTGACTTGCATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1192s21c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-5507s21c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1294s21c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005909
VALIDATED
MAP1B MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7068s21c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7785s21c1
Sequence:CCGGGGTGATGCAAGTCACTAAATTCTCGAGAATTTAGTGACTTGCATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1192s21c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-5507s21c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1294s21c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005909
VALIDATED
MAP1B MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7068s21c1
Sequence:CCGGGCTTGAAAGAATCCTCGGATACTCGAGTATCCGAGGATTCTTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-7785s21c1
Sequence:CCGGGGTGATGCAAGTCACTAAATTCTCGAGAATTTAGTGACTTGCATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1192s21c1
Sequence:CCGGGCCTGGAATAAACAGCATGTTCTCGAGAACATGCTGTTTATTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-5507s21c1
Sequence:CCGGCCCAGAGATATGTCCTTATATCTCGAGATATAAGGACATATCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005909.3-1294s21c1
Sequence:CCGGCCCTGACTTAGGAGTTGTATTCTCGAGAATACAACTCCTAAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)