EMAIL THIS PAGE TO A FRIEND

MAP1LC3A

microtubule-associated protein 1 light chain 3 alpha

105 Gene Product Result for
Synonyms: ATG8E LC3 LC3A MAP1ALC3 MAP1BLC3
UniProtKB ID: Q9H492, E1P5P4, E1P5P5, Q9BXW5
Gene ID:
Human(84557) Summary: MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]
Mouse(66734) microtubule-associated protein 1 light chain 3 alpha
Rat(362245) microtubule-associated protein 1 light chain 3 alpha
sheep(101118292) microtubule-associated protein 1 light chain 3 alpha
naked mole-rat(101710069) microtubule-associated protein 1 light chain 3 alpha
domestic guinea pig(100727852) microtubule-associated protein 1 light chain 3 alpha
Zebrafish(406466) microtubule-associated protein 1 light chain 3 alpha
dog(477201) microtubule-associated protein 1 light chain 3 alpha
cow(514547) microtubule-associated protein 1 light chain 3 alpha
domestic cat(101085618) microtubule-associated protein 1 light chain 3 alpha
chicken(419142) microtubule-associated protein 1 light chain 3 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306617 ANTI-CLEAVED LC3A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305639 ANTI-LC3 (APG8A) (D106) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1306673 ANTI-LC3 (APG8A) (N-TERM) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305638 ANTI-LC3 (APG8A) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
L8918 Anti-LC3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunoprecipitation (IP), western blot pricing
L8793 Anti-LC3A antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunoprecipitation (IP), western blot pricing
SAB1408113 Anti-MAP1LC3A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007649 Anti-MAP1LC3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2101425 Anti-MAP1LC3A antibody produced in rabbit affinity isolated antibody horse, pig, human, zebrafish, guinea pig, canine, bovine, mouse, rat
western blot pricing
SAB4300571 Anti-MAP1LC3A antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB1411514 Anti-MAP1LC3A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB3501064 Anti-MAP1LC3A antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA052474 Anti-MAP1LC3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA052484 Anti-MAP1LC3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1306087 ANTI-PHOSPHO-LC3C(S12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1305552 MONOCLONAL ANTI-LC3 (APG8) antibody produced in mouse clone 166AT1234, IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0084557M7 Monoclonal Anti-MAP1LC3A antibody produced in mouse clone 1D5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088371 MISSION® esiRNA esiRNA human MAP1LC3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032514 Rosetta Predictions human pricing
NM_181509 Rosetta Predictions human pricing
NM_199500 Rosetta Predictions rat pricing
NM_025735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133990 predicted 438
2 SASI_Hs01_00133992 predicted 465
3 SASI_Hs02_00360008 predicted 465
4 SASI_Hs01_00133993 predicted 460
5 SASI_Hs01_00133994 predicted 455
6 SASI_Hs01_00133995 predicted 462
7 SASI_Hs02_00360009 predicted 558
8 SASI_Hs01_00133996 predicted 463
9 SASI_Hs01_00133997 predicted 431
10 SASI_Hs01_00133998 predicted 478
11 SASI_Hs01_00133991 predicted 418
12 SASI_Hs01_00133999 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178077 predicted 404
2 SASI_Hs01_00178079 predicted 426
3 SASI_Hs02_00370133 predicted 428
4 SASI_Hs01_00178080 predicted 418
5 SASI_Hs01_00178081 predicted 421
6 SASI_Hs01_00178082 predicted 421
7 SASI_Hs02_00370134 predicted 518
8 SASI_Hs01_00178083 predicted 431
9 SASI_Hs01_00178084 predicted 387
10 SASI_Hs01_00178085 predicted 438
11 SASI_Hs01_00178078 predicted 381
12 SASI_Hs01_00178086 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122347 predicted 402
2 SASI_Rn01_00122348 predicted 437
3 SASI_Rn01_00122349 predicted 468
4 SASI_Rn01_00122351 predicted 317
5 SASI_Rn01_00122352 predicted 321
6 SASI_Rn01_00122353 predicted 435
7 SASI_Rn01_00122354 predicted 423
8 SASI_Rn01_00122355 predicted 324
9 SASI_Rn01_00122356 predicted 459
10 SASI_Rn02_00270274 predicted 461
11 SASI_Rn01_00122350 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184003 predicted 265
2 SASI_Mm01_00184004 predicted 288
3 SASI_Mm01_00184005 predicted 230
4 SASI_Mm01_00184006 predicted 242
5 SASI_Mm02_00328917 predicted 319
6 SASI_Mm01_00184007 predicted 341
7 SASI_Mm01_00184008 predicted 344
8 SASI_Mm01_00184009 predicted 314
9 SASI_Mm01_00184010 predicted 344
10 SASI_Mm01_00184011 predicted 303
11 SASI_Mm01_00184002 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032514
MAP1LC3A MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-250s21c1
Sequence:CCGGGGTGATCATCGAGCGCTACAACTCGAGTTGTAGCGCTCGATGATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032514.2-765s21c1
Sequence:CCGGCCCTGCTGTGTGGTTCATCTTCTCGAGAAGATGAACCACACAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-335s21c1
Sequence:CCGGAGCGAGTTGGTCAAGATCATCCTCGAGGATGATCTTGACCAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-310s21c1
Sequence:CCGGTTTGGTCCCGGACCATGTCAACTCGAGTTGACATGGTCCGGGACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-468s21c1
Sequence:CCGGAGGACGGCTTCCTCTATATGGCTCGAGCCATATAGAGGAAGCCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032514.2-766s1c1
Sequence:CCGGCCTGCTGTGTGGTTCATCTTTCTCGAGAAAGATGAACCACACAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032514.2-445s1c1
Sequence:CCGGCATCTACGAGCAGGAGAAAGACTCGAGTCTTTCTCCTGCTCGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032514
MAP1LC3A MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-250s21c1
Sequence:CCGGGGTGATCATCGAGCGCTACAACTCGAGTTGTAGCGCTCGATGATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032514.2-765s21c1
Sequence:CCGGCCCTGCTGTGTGGTTCATCTTCTCGAGAAGATGAACCACACAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-335s21c1
Sequence:CCGGAGCGAGTTGGTCAAGATCATCCTCGAGGATGATCTTGACCAACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-310s21c1
Sequence:CCGGTTTGGTCCCGGACCATGTCAACTCGAGTTGACATGGTCCGGGACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-468s21c1
Sequence:CCGGAGGACGGCTTCCTCTATATGGCTCGAGCCATATAGAGGAAGCCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032514.2-766s1c1
Sequence:CCGGCCTGCTGTGTGGTTCATCTTTCTCGAGAAAGATGAACCACACAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032514.2-445s1c1
Sequence:CCGGCATCTACGAGCAGGAGAAAGACTCGAGTCTTTCTCCTGCTCGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032514
MAP1LC3A MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-250s21c1
Sequence:CCGGGGTGATCATCGAGCGCTACAACTCGAGTTGTAGCGCTCGATGATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032514.2-765s21c1
Sequence:CCGGCCCTGCTGTGTGGTTCATCTTCTCGAGAAGATGAACCACACAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-335s21c1
Sequence:CCGGAGCGAGTTGGTCAAGATCATCCTCGAGGATGATCTTGACCAACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-310s21c1
Sequence:CCGGTTTGGTCCCGGACCATGTCAACTCGAGTTGACATGGTCCGGGACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032514.2-468s21c1
Sequence:CCGGAGGACGGCTTCCTCTATATGGCTCGAGCCATATAGAGGAAGCCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032514.2-766s1c1
Sequence:CCGGCCTGCTGTGTGGTTCATCTTTCTCGAGAAAGATGAACCACACAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032514.2-445s1c1
Sequence:CCGGCATCTACGAGCAGGAGAAAGACTCGAGTCTTTCTCCTGCTCGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025735
VALIDATED
MAP1LC3A MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 alpha
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000120793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-311s1c1
Sequence:CCGGCCATGTTAACATGAGCGAGTTCTCGAGAACTCGCTCATGTTAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-320s1c1
Sequence:CCGGCATGAGCGAGTTGGTCAAGATCTCGAGATCTTGACCAACTCGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025735.1-248s1c1
Sequence:CCGGCGAGCGCTACAAGGGTGAGAACTCGAGTTCTCACCCTTGTAGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025735
VALIDATED
MAP1LC3A MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 alpha
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000120793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-311s1c1
Sequence:CCGGCCATGTTAACATGAGCGAGTTCTCGAGAACTCGCTCATGTTAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-320s1c1
Sequence:CCGGCATGAGCGAGTTGGTCAAGATCTCGAGATCTTGACCAACTCGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025735.1-248s1c1
Sequence:CCGGCGAGCGCTACAAGGGTGAGAACTCGAGTTCTCACCCTTGTAGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025735
VALIDATED
MAP1LC3A MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 alpha
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000120793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-311s1c1
Sequence:CCGGCCATGTTAACATGAGCGAGTTCTCGAGAACTCGCTCATGTTAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025735.1-320s1c1
Sequence:CCGGCATGAGCGAGTTGGTCAAGATCTCGAGATCTTGACCAACTCGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025735.1-248s1c1
Sequence:CCGGCGAGCGCTACAAGGGTGAGAACTCGAGTTCTCACCCTTGTAGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)