EMAIL THIS PAGE TO A FRIEND

MAP1LC3B2

microtubule-associated protein 1 light chain 3 beta 2

13 Gene Product Result for
Synonyms: ATG8G
Species: Human MAP1LC3B2(643246)
UniProtKB ID: A6NCE7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085481 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085481 Rosetta Predictions human pricing
XM_926608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317965 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293340 predicted 253
2 SASI_Hs01_00293341 predicted 452
3 SASI_Hs01_00293342 predicted 361
4 SASI_Hs01_00293343 predicted 357
5 SASI_Hs01_00293344 predicted 363
6 SASI_Hs01_00293345 predicted 299
7 SASI_Hs01_00293346 predicted 92
8 SASI_Hs01_00293347 predicted 34
9 SASI_Hs01_00293348 predicted 73
10 SASI_Hs01_00293349 predicted 57
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085481
MAP1LC3B2 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 beta 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-432s21c1
Sequence:CCGGCACCAATCTCAGAGGTGTATGCTCGAGCATACACCTCTGAGATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085481.1-607s21c1
Sequence:CCGGAGATCGATCAGTTCATCTAATCTCGAGATTAGATGAACTGATCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-333s21c1
Sequence:CCGGTGAGTGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-202s21c1
Sequence:CCGGAGTAGAAGATGTCCGACTTATCTCGAGATAAGTCGGACATCTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-513s21c1
Sequence:CCGGGGATGAAATTGTCAGTGTAAACTCGAGTTTACACTGACAATTTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085481
MAP1LC3B2 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 beta 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-432s21c1
Sequence:CCGGCACCAATCTCAGAGGTGTATGCTCGAGCATACACCTCTGAGATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085481.1-607s21c1
Sequence:CCGGAGATCGATCAGTTCATCTAATCTCGAGATTAGATGAACTGATCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-333s21c1
Sequence:CCGGTGAGTGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-202s21c1
Sequence:CCGGAGTAGAAGATGTCCGACTTATCTCGAGATAAGTCGGACATCTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-513s21c1
Sequence:CCGGGGATGAAATTGTCAGTGTAAACTCGAGTTTACACTGACAATTTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085481
MAP1LC3B2 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 beta 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-432s21c1
Sequence:CCGGCACCAATCTCAGAGGTGTATGCTCGAGCATACACCTCTGAGATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085481.1-607s21c1
Sequence:CCGGAGATCGATCAGTTCATCTAATCTCGAGATTAGATGAACTGATCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-333s21c1
Sequence:CCGGTGAGTGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-202s21c1
Sequence:CCGGAGTAGAAGATGTCCGACTTATCTCGAGATAAGTCGGACATCTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085481.1-513s21c1
Sequence:CCGGGGATGAAATTGTCAGTGTAAACTCGAGTTTACACTGACAATTTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)