EMAIL THIS PAGE TO A FRIEND

MAP1LC3B

microtubule-associated protein 1 light chain 3 beta

93 Gene Product Result for
Synonyms: ATG8F LC3B MAP1A/1BLC3 MAP1LC3B-a
UniProtKB ID: Q9GZQ8, Q6NW02
Gene ID:
Human(81631) Summary: The product of this gene is a subunit of neuronal microtubule-associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. Studies on the rat homolog implicate a role for this gene in autophagy, a process that involves the bulk degradation of cytoplasmic component. [provided by RefSeq, Jul 2008]
Mouse(67443) microtubule-associated protein 1 light chain 3 beta
Rat(64862) microtubule-associated protein 1 light chain 3 beta
Zebrafish(322425) microtubule-associated protein 1 light chain 3 beta
cow(408001) microtubule-associated protein 1 light chain 3 beta
dog(479619) microtubule-associated protein 1 light chain 3 beta
chicken(427559) microtubule-associated protein 1 light chain 3 beta
domestic guinea pig(100726328) microtubule-associated protein 1 light chain 3 beta
naked mole-rat(101709236) microtubule-associated protein 1 light chain 3 beta
sheep(101105939) microtubule-associated protein 1 light chain 3 beta
sheep(100913172) microtubule-associated protein 1 light chain 3 beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305641 ANTI-APG8A/B(MAP1LC3A/B) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306483 ANTI-APG8B (MAP1LC3B)-T93/Y99 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1306475 ANTI-APG8B(MAP1LC3B) (N-TERM T29) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1305635 ANTI-CLEAVED LC3B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunofluorescence pricing
SAB1306269 ANTI-LC3 (APG8A/B) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB1306268 ANTI-LC3 (APG8B) (C-TERM) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306611 ANTI-LC3 (APG8B) (N-TERM) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305776 ANTI-LC3 (APG8B) (T6) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
L8918 Anti-LC3 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunoprecipitation (IP), western blot pricing
L7543 Anti-LC3B antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, western blot pricing
SAB4200361 Anti-LC3B antibody, Mouse monoclonal clone LC3B-6, purified from hybridoma cell culture human
immunoprecipitation (IP), western blot pricing
SAB2700738 Anti-Map1lc3b antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB3501065 Anti-MAP1LC3B antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
HPA053767 Anti-MAP1LC3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA043000 Anti-MAP1LC3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1305595 ANTI-PHOSPHO-APG8B(MAP1LC3B)(T29) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB1305583 ANTI-PHOSPHO-LC3B(T12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
WH0081631M1 Monoclonal Anti-MAP1LC3B antibody produced in mouse clone 4E11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1405293 Monoclonal Anti-MAP1LC3B antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022818 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002651 MISSION® esiRNA esiRNA targeting human MAP1LC3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022818 Rosetta Predictions human pricing
NM_022867 Rosetta Predictions rat pricing
NM_026160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356118 predicted 1024
2 SASI_Hs01_00212376 predicted 929
3 SASI_Hs01_00212377 predicted 922
4 SASI_Hs01_00212379 predicted 1049
5 SASI_Hs01_00212380 predicted 901
6 SASI_Hs01_00212378 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074985 predicted 256
2 SASI_Rn01_00074986 predicted 248
3 SASI_Rn01_00074987 predicted 565
4 SASI_Rn01_00074989 predicted 897
5 SASI_Rn01_00074990 predicted 582
6 SASI_Rn01_00074991 predicted 612
7 SASI_Rn01_00074992 predicted 881
8 SASI_Rn01_00074993 predicted 728
9 SASI_Rn01_00074994 predicted 239
10 SASI_Rn02_00263604 predicted 633
11 SASI_Rn01_00074988 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329773 predicted 711
2 SASI_Mm02_00329774 predicted 875
3 SASI_Mm02_00329775 predicted 869
4 SASI_Mm02_00329776 predicted 878
5 SASI_Mm02_00329777 predicted 853
6 SASI_Mm02_00329778 predicted 312
7 SASI_Mm02_00329779 predicted 666
8 SASI_Mm02_00329780 predicted 389
9 SASI_Mm02_00329781 predicted 925
10 SASI_Mm02_00329782 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026160
VALIDATED
MAP1LC3B MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 beta
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026160.1-670s1c1
Sequence:CCGGGCATCCTAAGTTGCCAATAAACTCGAGTTTATTGGCAACTTAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026160.1-274s1c1
Sequence:CCGGGCTCAATGCTAACCAAGCCTTCTCGAGAAGGCTTGGTTAGCATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-251s21c1
Sequence:CCGGAGATAATCAGACGGCGCTTGCCTCGAGGCAAGCGCCGTCTGATTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-341s21c1
Sequence:CCGGTCTCCGAAGTGTACGAGAGTGCTCGAGCACTCTCGTACACTTCGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-406s21c1
Sequence:CCGGGAGACATTCGGGACAGCAATGCTCGAGCATTGCTGTCCCGAATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-236s21c1
Sequence:CCGGTGAGCGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026160
VALIDATED
MAP1LC3B MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 beta
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026160.1-670s1c1
Sequence:CCGGGCATCCTAAGTTGCCAATAAACTCGAGTTTATTGGCAACTTAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026160.1-274s1c1
Sequence:CCGGGCTCAATGCTAACCAAGCCTTCTCGAGAAGGCTTGGTTAGCATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-251s21c1
Sequence:CCGGAGATAATCAGACGGCGCTTGCCTCGAGGCAAGCGCCGTCTGATTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-341s21c1
Sequence:CCGGTCTCCGAAGTGTACGAGAGTGCTCGAGCACTCTCGTACACTTCGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-406s21c1
Sequence:CCGGGAGACATTCGGGACAGCAATGCTCGAGCATTGCTGTCCCGAATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-236s21c1
Sequence:CCGGTGAGCGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026160
VALIDATED
MAP1LC3B MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 beta
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026160.1-670s1c1
Sequence:CCGGGCATCCTAAGTTGCCAATAAACTCGAGTTTATTGGCAACTTAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026160.1-274s1c1
Sequence:CCGGGCTCAATGCTAACCAAGCCTTCTCGAGAAGGCTTGGTTAGCATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-251s21c1
Sequence:CCGGAGATAATCAGACGGCGCTTGCCTCGAGGCAAGCGCCGTCTGATTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-341s21c1
Sequence:CCGGTCTCCGAAGTGTACGAGAGTGCTCGAGCACTCTCGTACACTTCGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-406s21c1
Sequence:CCGGGAGACATTCGGGACAGCAATGCTCGAGCATTGCTGTCCCGAATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026160.4-236s21c1
Sequence:CCGGTGAGCGAGCTCATCAAGATAACTCGAGTTATCTTGATGAGCTCGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022818
VALIDATED
MAP1LC3B MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-115s1c1
Sequence:CCGGCGCACCTTCGAACAAAGAGTACTCGAGTACTCTTTGTTCGAAGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-276s1c1
Sequence:CCGGCAAGATAATTAGAAGGCGCTTCTCGAGAAGCGCCTTCTAATTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-123s1c1
Sequence:CCGGCGAACAAAGAGTAGAAGATGTCTCGAGACATCTTCTACTCTTTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-373s1c1
Sequence:CCGGGAGGTGTATGAGAGTGAGAAACTCGAGTTTCTCACTCTCATACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-438s1c1
Sequence:CCGGGTTCGGGATGAAATTGTCAGTCTCGAGACTGACAATTTCATCCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-131s1c1
Sequence:CCGGGAGTAGAAGATGTCCGACTTACTCGAGTAAGTCGGACATCTTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-211s1c1
Sequence:CCGGCAGCTTCCTGTTCTGGATAAACTCGAGTTTATCCAGAACAGGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-247s1c1
Sequence:CCGGCCTGACCATGTCAACATGAGTCTCGAGACTCATGTTGACATGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-145s1c1
Sequence:CCGGCGACTTATTCGAGAGCAGCATCTCGAGATGCTGCTCTCGAATAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-177s1c1
Sequence:CCGGCCCGGTGATAATAGAACGATACTCGAGTATCGTTCTATTATCACCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-292s1c1
Sequence:CCGGCGCTTACAGCTCAATGCTAATCTCGAGATTAGCATTGAGCTGTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022818
VALIDATED
MAP1LC3B MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-115s1c1
Sequence:CCGGCGCACCTTCGAACAAAGAGTACTCGAGTACTCTTTGTTCGAAGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-276s1c1
Sequence:CCGGCAAGATAATTAGAAGGCGCTTCTCGAGAAGCGCCTTCTAATTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-123s1c1
Sequence:CCGGCGAACAAAGAGTAGAAGATGTCTCGAGACATCTTCTACTCTTTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-373s1c1
Sequence:CCGGGAGGTGTATGAGAGTGAGAAACTCGAGTTTCTCACTCTCATACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-438s1c1
Sequence:CCGGGTTCGGGATGAAATTGTCAGTCTCGAGACTGACAATTTCATCCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-131s1c1
Sequence:CCGGGAGTAGAAGATGTCCGACTTACTCGAGTAAGTCGGACATCTTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-211s1c1
Sequence:CCGGCAGCTTCCTGTTCTGGATAAACTCGAGTTTATCCAGAACAGGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-247s1c1
Sequence:CCGGCCTGACCATGTCAACATGAGTCTCGAGACTCATGTTGACATGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-145s1c1
Sequence:CCGGCGACTTATTCGAGAGCAGCATCTCGAGATGCTGCTCTCGAATAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-177s1c1
Sequence:CCGGCCCGGTGATAATAGAACGATACTCGAGTATCGTTCTATTATCACCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-292s1c1
Sequence:CCGGCGCTTACAGCTCAATGCTAATCTCGAGATTAGCATTGAGCTGTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022818
VALIDATED
MAP1LC3B MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-115s1c1
Sequence:CCGGCGCACCTTCGAACAAAGAGTACTCGAGTACTCTTTGTTCGAAGGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-276s1c1
Sequence:CCGGCAAGATAATTAGAAGGCGCTTCTCGAGAAGCGCCTTCTAATTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-123s1c1
Sequence:CCGGCGAACAAAGAGTAGAAGATGTCTCGAGACATCTTCTACTCTTTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-373s1c1
Sequence:CCGGGAGGTGTATGAGAGTGAGAAACTCGAGTTTCTCACTCTCATACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022818.2-438s1c1
Sequence:CCGGGTTCGGGATGAAATTGTCAGTCTCGAGACTGACAATTTCATCCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-131s1c1
Sequence:CCGGGAGTAGAAGATGTCCGACTTACTCGAGTAAGTCGGACATCTTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022818.2-211s1c1
Sequence:CCGGCAGCTTCCTGTTCTGGATAAACTCGAGTTTATCCAGAACAGGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-247s1c1
Sequence:CCGGCCTGACCATGTCAACATGAGTCTCGAGACTCATGTTGACATGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-145s1c1
Sequence:CCGGCGACTTATTCGAGAGCAGCATCTCGAGATGCTGCTCTCGAATAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022818.2-177s1c1
Sequence:CCGGCCCGGTGATAATAGAACGATACTCGAGTATCGTTCTATTATCACCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022818.2-292s1c1
Sequence:CCGGCGCTTACAGCTCAATGCTAATCTCGAGATTAGCATTGAGCTGTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)