EMAIL THIS PAGE TO A FRIEND

MAP1LC3C

microtubule-associated protein 1 light chain 3 gamma

37 Gene Product Result for
Synonyms: ATG8J LC3C
UniProtKB ID: Q9BXW4, A0PJY8, A2RUP0
Gene ID:
Human(440738) Summary: Autophagy is a highly regulated bulk degradation process that plays an important role in cellular maintenance and development. MAP1LC3C is an ortholog of the yeast autophagosome protein Atg8 (He et al., 2003 [PubMed 12740394]
Zebrafish(393268) microtubule-associated protein 1 light chain 3 gamma
dog(611659) microtubule-associated protein 1 light chain 3 gamma
chicken(421504) microtubule-associated protein 1 light chain 3 gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302734 ANTI-LC3 (APG8C) (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1301290 ANTI-LC3 (APG8C) (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB1302735 ANTI-LC3 (APG8C) (S138) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1301850 ANTI-LC3 (APG8C) (T48) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1301851 ANTI-LC3 (APG8C) (Y105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB3501066 Anti-MAP1LC3C antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA072670 Anti-MAP1LC3C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4300853 Anti-MAP1LC3C antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1302795 ANTI-PHOSPHO-APG8C (MAP1LC3C)-Y105 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302792 ANTI-PHOSPHO-LC3C-S137/138 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302791 ANTI-PHOSPHO-LC3C-S9 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302793 ANTI-PHOSPHO-LC3C-T48 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing
SAB1302794 ANTI-PHOSPHO-MAP1LC3C-Y105 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004343 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163395 predicted 490
2 SASI_Hs01_00163397 predicted 514
3 SASI_Hs01_00163398 predicted 356
4 SASI_Hs01_00163399 predicted 390
5 SASI_Hs01_00163400 predicted 343
6 SASI_Hs01_00163401 predicted 501
7 SASI_Hs01_00163402 predicted 356
8 SASI_Hs01_00163403 predicted 346
9 SASI_Hs01_00163404 predicted 293
10 SASI_Hs02_00304563 predicted 363
11 SASI_Hs01_00163396 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004343
MAP1LC3C MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1 light chain 3 gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-679s1c1
Sequence:CCGGCCGTGTTCTTGTGTCCTTCTACTCGAGTAGAAGGACACAAGAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-376s1c1
Sequence:CCGGCTACAGAGACTACAAGGATGACTCGAGTCATCCTTGTAGTCTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-122s1c1
Sequence:CCGGGCAATCAGACAAGAGGAAGTTCTCGAGAACTTCCTCTTGTCTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-683s1c1
Sequence:CCGGGTTCTTGTGTCCTTCTAAGAACTCGAGTTCTTAGAAGGACACAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-712s1c1
Sequence:CCGGGCTGCTCTTGAAAGTTATATACTCGAGTATATAACTTTCAAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-1029s1c1
Sequence:CCGGCCAGCCATATAACCGTATTCTCTCGAGAGAATACGGTTATATGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-129s1c1
Sequence:CCGGGACAAGAGGAAGTTGCTGGAACTCGAGTTCCAGCAACTTCCTCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004343
MAP1LC3C MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1 light chain 3 gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-679s1c1
Sequence:CCGGCCGTGTTCTTGTGTCCTTCTACTCGAGTAGAAGGACACAAGAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-376s1c1
Sequence:CCGGCTACAGAGACTACAAGGATGACTCGAGTCATCCTTGTAGTCTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-122s1c1
Sequence:CCGGGCAATCAGACAAGAGGAAGTTCTCGAGAACTTCCTCTTGTCTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-683s1c1
Sequence:CCGGGTTCTTGTGTCCTTCTAAGAACTCGAGTTCTTAGAAGGACACAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-712s1c1
Sequence:CCGGGCTGCTCTTGAAAGTTATATACTCGAGTATATAACTTTCAAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-1029s1c1
Sequence:CCGGCCAGCCATATAACCGTATTCTCTCGAGAGAATACGGTTATATGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-129s1c1
Sequence:CCGGGACAAGAGGAAGTTGCTGGAACTCGAGTTCCAGCAACTTCCTCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004343
MAP1LC3C MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1 light chain 3 gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-679s1c1
Sequence:CCGGCCGTGTTCTTGTGTCCTTCTACTCGAGTAGAAGGACACAAGAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-376s1c1
Sequence:CCGGCTACAGAGACTACAAGGATGACTCGAGTCATCCTTGTAGTCTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-122s1c1
Sequence:CCGGGCAATCAGACAAGAGGAAGTTCTCGAGAACTTCCTCTTGTCTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-683s1c1
Sequence:CCGGGTTCTTGTGTCCTTCTAAGAACTCGAGTTCTTAGAAGGACACAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-712s1c1
Sequence:CCGGGCTGCTCTTGAAAGTTATATACTCGAGTATATAACTTTCAAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004343.1-1029s1c1
Sequence:CCGGCCAGCCATATAACCGTATTCTCTCGAGAGAATACGGTTATATGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004343.1-129s1c1
Sequence:CCGGGACAAGAGGAAGTTGCTGGAACTCGAGTTCCAGCAACTTCCTCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)