EMAIL THIS PAGE TO A FRIEND

MAP1S

microtubule-associated protein 1S

59 Gene Product Result for
Synonyms: BPY2IP1 C19orf5 MAP8 VCY2IP-1 VCY2IP1
Gene ID:
Mouse(270058) microtubule-associated protein 1S
Rat(290640) microtubule-associated protein 1S
dog(100688192) microtubule-associated protein 1S
cow(527829) microtubule-associated protein 1S
domestic cat(101091851) microtubule-associated protein 1S
sheep(101113329) microtubule-associated protein 1S
naked mole-rat(101697271) microtubule-associated protein 1S
domestic guinea pig(100735808) microtubule-associated protein 1S
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibody Arrays

Product # Description Species Add to Cart
 
AQ0355 AQUA Peptide DPLPD[P]LLDK human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038191 MISSION® esiRNA esiRNA targeting mouse Mtap1s (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018174 Rosetta Predictions human pricing
NM_001106070 Rosetta Predictions rat pricing
XM_214321 Rosetta Predictions rat pricing
NM_173013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211432 predicted 1275
2 SASI_Hs01_00211433 predicted 770
3 SASI_Hs01_00211434 predicted 510
4 SASI_Hs01_00211435 predicted 281
5 SASI_Hs01_00211436 predicted 481
6 SASI_Hs01_00211437 predicted 2240
7 SASI_Hs01_00211438 predicted 1014
8 SASI_Hs01_00211439 predicted 2707
9 SASI_Hs01_00211440 predicted 335
10 SASI_Hs01_00211441 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215332 predicted 1351
2 SASI_Rn02_00215333 predicted 670
3 SASI_Rn02_00215334 predicted 2160
4 SASI_Rn02_00215335 predicted 1778
5 SASI_Rn02_00215336 predicted 2926
6 SASI_Rn02_00215337 predicted 2838
7 SASI_Rn02_00215338 predicted 323
8 SASI_Rn02_00215339 predicted 2776
9 SASI_Rn02_00215340 predicted 777
10 SASI_Rn02_00215341 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190305 predicted 1357
2 SASI_Rn01_00190306 predicted 669
3 SASI_Rn01_00190307 predicted 1776
4 SASI_Rn01_00190308 predicted 2927
5 SASI_Rn01_00190309 predicted 2832
6 SASI_Rn01_00190310 predicted 323
7 SASI_Rn01_00190311 predicted 2784
8 SASI_Rn01_00190312 predicted 784
9 SASI_Rn01_00190313 predicted 1394
10 SASI_Rn01_00190314 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154579 predicted 2778
2 SASI_Mm01_00154580 predicted 2932
3 SASI_Mm01_00154581 predicted 1598
4 SASI_Mm01_00154582 predicted 1267
5 SASI_Mm01_00154584 predicted 1537
6 SASI_Mm01_00154585 predicted 2143
7 SASI_Mm01_00154586 predicted 774
8 SASI_Mm01_00154587 predicted 2822
9 SASI_Mm02_00345072 predicted 2512
10 SASI_Mm01_00154588 predicted 1765
11 SASI_Mm01_00154583 predicted 1919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018174
MAP1S MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1S
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-130s21c1
Sequence:CCGGATCCGGTCTTGGGATGTCGATCTCGAGATCGACATCCCAAGACCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-155s1c1
Sequence:CCGGGCAACCTTGATGAACAGCTCACTCGAGTGAGCTGTTCATCAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-280s1c1
Sequence:CCGGCCATCAGACAAGTCCCTGTATCTCGAGATACAGGGACTTGTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-2437s21c1
Sequence:CCGGGACGAAGACACAGAGGGCTTTCTCGAGAAAGCCCTCTGTGTCTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-165s1c1
Sequence:CCGGCCTTGATGAACAGCTCAAGGTCTCGAGACCTTGAGCTGTTCATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-163s1c1
Sequence:CCGGGATGAACAGCTCAAGGTCTTTCTCGAGAAAGACCTTGAGCTGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-162s1c1
Sequence:CCGGCAACCTTGATGAACAGCTCAACTCGAGTTGAGCTGTTCATCAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-1542s1c1
Sequence:CCGGCAAGACTGAGAAAGAAGCCAACTCGAGTTGGCTTCTTTCTCAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018174
MAP1S MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1S
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-130s21c1
Sequence:CCGGATCCGGTCTTGGGATGTCGATCTCGAGATCGACATCCCAAGACCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-155s1c1
Sequence:CCGGGCAACCTTGATGAACAGCTCACTCGAGTGAGCTGTTCATCAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-280s1c1
Sequence:CCGGCCATCAGACAAGTCCCTGTATCTCGAGATACAGGGACTTGTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-2437s21c1
Sequence:CCGGGACGAAGACACAGAGGGCTTTCTCGAGAAAGCCCTCTGTGTCTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-165s1c1
Sequence:CCGGCCTTGATGAACAGCTCAAGGTCTCGAGACCTTGAGCTGTTCATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-163s1c1
Sequence:CCGGGATGAACAGCTCAAGGTCTTTCTCGAGAAAGACCTTGAGCTGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-162s1c1
Sequence:CCGGCAACCTTGATGAACAGCTCAACTCGAGTTGAGCTGTTCATCAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-1542s1c1
Sequence:CCGGCAAGACTGAGAAAGAAGCCAACTCGAGTTGGCTTCTTTCTCAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018174
MAP1S MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1S
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-130s21c1
Sequence:CCGGATCCGGTCTTGGGATGTCGATCTCGAGATCGACATCCCAAGACCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-155s1c1
Sequence:CCGGGCAACCTTGATGAACAGCTCACTCGAGTGAGCTGTTCATCAAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-280s1c1
Sequence:CCGGCCATCAGACAAGTCCCTGTATCTCGAGATACAGGGACTTGTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018174.4-2437s21c1
Sequence:CCGGGACGAAGACACAGAGGGCTTTCTCGAGAAAGCCCTCTGTGTCTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-165s1c1
Sequence:CCGGCCTTGATGAACAGCTCAAGGTCTCGAGACCTTGAGCTGTTCATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-163s1c1
Sequence:CCGGGATGAACAGCTCAAGGTCTTTCTCGAGAAAGACCTTGAGCTGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.4-162s1c1
Sequence:CCGGCAACCTTGATGAACAGCTCAACTCGAGTTGAGCTGTTCATCAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018174.3-1542s1c1
Sequence:CCGGCAAGACTGAGAAAGAAGCCAACTCGAGTTGGCTTCTTTCTCAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173013
VALIDATED
MAP1S MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 1S
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1766s21c1
Sequence:CCGGCACCTACAGCACCTGGTAATACTCGAGTATTACCAGGTGCTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-774s21c1
Sequence:CCGGCTTCGCTGTCAACGGCTTTACCTCGAGGTAAAGCCGTTGACAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-3025s21c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-1261s1c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1273s21c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2399s1c1
Sequence:CCGGCAACTGTAGCTGCCAAGACAACTCGAGTTGTCTTGGCAGCTACAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1605s21c1
Sequence:CCGGCAACACAAAGCCTCGTGTATCCTCGAGGATACACGAGGCTTTGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-3013s1c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2149s1c1
Sequence:CCGGCCCACACTATCTGACTCTGATCTCGAGATCAGAGTCAGATAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-695s1c1
Sequence:CCGGGCGGCTTTCTGCGCTTAGCAACTCGAGTTGCTAAGCGCAGAAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173013
VALIDATED
MAP1S MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 1S
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1766s21c1
Sequence:CCGGCACCTACAGCACCTGGTAATACTCGAGTATTACCAGGTGCTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-774s21c1
Sequence:CCGGCTTCGCTGTCAACGGCTTTACCTCGAGGTAAAGCCGTTGACAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-3025s21c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-1261s1c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1273s21c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2399s1c1
Sequence:CCGGCAACTGTAGCTGCCAAGACAACTCGAGTTGTCTTGGCAGCTACAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1605s21c1
Sequence:CCGGCAACACAAAGCCTCGTGTATCCTCGAGGATACACGAGGCTTTGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-3013s1c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2149s1c1
Sequence:CCGGCCCACACTATCTGACTCTGATCTCGAGATCAGAGTCAGATAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-695s1c1
Sequence:CCGGGCGGCTTTCTGCGCTTAGCAACTCGAGTTGCTAAGCGCAGAAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173013
VALIDATED
MAP1S MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 1S
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1766s21c1
Sequence:CCGGCACCTACAGCACCTGGTAATACTCGAGTATTACCAGGTGCTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-774s21c1
Sequence:CCGGCTTCGCTGTCAACGGCTTTACCTCGAGGTAAAGCCGTTGACAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-3025s21c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-1261s1c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1273s21c1
Sequence:CCGGGACAAGGTTGTGCGTGTACTACTCGAGTAGTACACGCACAACCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2399s1c1
Sequence:CCGGCAACTGTAGCTGCCAAGACAACTCGAGTTGTCTTGGCAGCTACAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173013.3-1605s21c1
Sequence:CCGGCAACACAAAGCCTCGTGTATCCTCGAGGATACACGAGGCTTTGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173013.1-3013s1c1
Sequence:CCGGCAAAGCTAGATCCCGTGCTTACTCGAGTAAGCACGGGATCTAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-2149s1c1
Sequence:CCGGCCCACACTATCTGACTCTGATCTCGAGATCAGAGTCAGATAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173013.1-695s1c1
Sequence:CCGGGCGGCTTTCTGCGCTTAGCAACTCGAGTTGCTAAGCGCAGAAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)