EMAIL THIS PAGE TO A FRIEND

MAP2

microtubule-associated protein 2

224 Gene Product Result for
Synonyms: MAP2A MAP2B MAP2C
UniProtKB ID: P11137, Q17S04, Q8IUX2, Q99975, Q99976
Gene ID:
Human(4133) Summary: This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
Mouse(17756) microtubule-associated protein 2
Rat(25595) microtubule-associated protein 2
domestic guinea pig(100729384) microtubule-associated protein 2
naked mole-rat(101702905) microtubule-associated protein 2
sheep(101121239) microtubule-associated protein 2
Zebrafish(450004) microtubule-associated protein 2
cow(281294) microtubule-associated protein 2
chicken(424001) microtubule-associated protein 2
dog(488504) microtubule-associated protein 2
Horse(100049852) microtubule-associated protein 2
domestic cat(101095036) microtubule-associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M3696 Anti-MAP2 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
flow cytometry, immunohistochemistry, western blot pricing
HPA008273 Anti-MAP2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA012828 Anti-MAP2 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry pricing
SAB4300658 Anti-MAP2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
M9942 Anti-MAP2 antibody, Mouse Monoclonal clone HM-2, purified from hybridoma cell culture human, chicken, rat, mouse, quail, bovine
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
M7273 Anti-Microtubule-Associated Proteins (MAPs) antibody produced in rabbit whole antiserum mammals
western blot pricing
M1406 Monoclonal Anti-MAP2 (2a+2b) antibody produced in mouse clone AP-20, ascites fluid human, Xenopus, mouse, rat, aquatic salamander, quail, bovine
immunocytochemistry, western blot pricing
M2320 Monoclonal Anti-MAP2 (2a+2b) antibody produced in mouse ~2 mg/mL, clone AP-20, purified immunoglobulin, buffered aqueous solution human, Xenopus, mouse, rat, aquatic salamander, quail, bovine
immunocytochemistry, microarray, western blot pricing
AMAB91375 Monoclonal Anti-MAP2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL5420, purified immunoglobulin, buffered aqueous glycerol solution New human
immunofluorescence, immunohistochemistry, western blot pricing
M4403 Monoclonal Anti-MAP2 antibody produced in mouse ascites fluid, clone HM-2 human, chicken, rat, mouse, quail, bovine
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097681 MISSION® esiRNA esiRNA human MAP2 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
AB5622-I Anti-MAP-2 Anti-MAP-2, Cat. No. AB5622-I, is a highly specific rabbit polyclonal antibody that targets microtubule-associated protein 2 and has been tested in Immunocytochemistry, Immunohistochemistry (Paraffin), and Western Blotting. pricing
AB2290 Anti-MAP-2 Antibody Anti-MAP-2 Antibody, Cat. No. AB2290, is a highly specific rabbit polyclonal antibody that targets rat MAP-2 and has been tested in Immunocytochemistry, Immunohistochemistry (Paraffin), and Western Blotting. pricing
AB2290B Anti-MAP-2 Antibody, Biotin Conjugate | AB2290B pricing
AB2290A4 Anti-MAP2, Alexa Fluor® 488 Conjugate Antibody This Anti-MAP2, Alexa Fluor 488 Conjugate Antibody is validated for use in ICC, IHC for the detection of MAP2. pricing
AB15452 Anti-MAP2 Antibody Anti-MAP2 Antibody detects level of MAP2 & has been published & validated for use in IC, IH. pricing
AB5543 Anti-MAP2 Antibody Anti-MAP2 Antibody is an antibody against MAP2 for use in IC, IH & WB. pricing
MAB3418X Anti-MAP2 Antibody, Alexa Fluor® 488 conjugated This Anti-MAP2 Antibody, Alexa Fluor 488 conjugated is validated for use in IH for the detection of MAP2. pricing
05-346 Anti-MAP2 Antibody, clone 5F9 Detect MAP2 using this Anti-MAP2 Antibody, clone 5F9 validated for use in WB, IH. pricing
MAB3418 Anti-MAP2 Antibody, clone AP20 Anti-MAP2 Antibody, clone AP20 detects level of MAP2 & has been published & validated for use in IH & WB. pricing
MAB3418A5 Anti-MAP2 Antibody, clone AP20, Alexa Fluor® 555 Conjugate This Anti-MAP2 Antibody, clone AP20, Alexa Fluor 555 Conjugate is validated for use in ICC for the detection of MAP2. pricing
MAB3418B Anti-MAP2 Antibody, clone AP20, Biotin Conjugated Anti-MAP2 Antibody, clone AP20, Biotin Conjugated is an antibody against MAP2 for use in ICC. pricing
MAB3418C3 Anti-MAP2 Antibody, clone AP20, Cy3 Conjugate Anti-MAP2 Antibody, clone AP20, Cy3 Conjugate is an antibody against MAP2 for use in IC. pricing
AB2290C3 Anti-MAP2, Cy3 Conjugate Antibody Detect MAP2 using this Anti-MAP2, Cy3 Conjugate Antibody validated for use in ICC. pricing
MAB364 Anti-MAP2A, 2B, 2C Antibody, clone HM-2 Anti-MAP2A Antibody, 2B, 2C, clone HM-2 detects level of MAP2A & has been published & validated for use in WB, IH. pricing
MAB378 Anti-MAP2A Antibody, 2B Detect MAP2A using this Anti-MAP2A Antibody, 2B validated for use in IH & WB. pricing
AB5622 Anti-Microtubule-Associated Protein 2 (MAP2) Antibody Detect Microtubule-Associated Protein 2 (MAP2) using this Anti-Microtubule-Associated Protein 2 (MAP2) Antibody validated for use in ELISA, IC, IH, IH(P) & WB with more than 55 product citations. pricing
FCMAB318PE Milli-Mark™ Anti-MAP2-PE Antibody, clone AP20 Milli-Mark Anti-MAP2-PE Antibody, clone AP20 is an antibody against MAP2 for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039538 Rosetta Predictions human pricing
NM_002374 Rosetta Predictions human pricing
NM_031845 Rosetta Predictions human pricing
NM_031847 Rosetta Predictions human pricing
NM_013066 Rosetta Predictions rat pricing
NM_001039934 Rosetta Predictions mouse pricing
NM_008632 Rosetta Predictions mouse pricing
XM_001001964 Rosetta Predictions mouse pricing
XM_001001973 Rosetta Predictions mouse pricing
XM_001001985 Rosetta Predictions mouse pricing
XM_001002002 Rosetta Predictions mouse pricing
XM_001002009 Rosetta Predictions mouse pricing
XM_001002017 Rosetta Predictions mouse pricing
XM_001002024 Rosetta Predictions mouse pricing
XM_001002035 Rosetta Predictions mouse pricing
XM_001002042 Rosetta Predictions mouse pricing
XM_001002051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015119 predicted 637
2 SASI_Hs01_00015120 predicted 2120
3 SASI_Hs01_00015121 predicted 2432
4 SASI_Hs01_00015122 predicted 2476
5 SASI_Hs02_00308555 predicted 615
6 SASI_Hs01_00015123 predicted 527
7 SASI_Hs01_00015124 predicted 1368
8 SASI_Hs01_00015125 predicted 1995
9 SASI_Hs01_00015126 predicted 598
10 SASI_Hs01_00015127 predicted 628
11 SASI_Hs01_00015128 predicted 2110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085153 predicted 440
2 SASI_Hs01_00085154 predicted 5730
3 SASI_Hs01_00085155 predicted 6034
4 SASI_Hs01_00085156 predicted 6076
5 SASI_Hs02_00333713 predicted 415
6 SASI_Hs01_00085157 predicted 320
7 SASI_Hs01_00085158 predicted 5058
8 SASI_Hs01_00085159 predicted 5597
9 SASI_Hs01_00085160 predicted 397
10 SASI_Hs01_00085161 predicted 432
11 SASI_Hs01_00085162 predicted 5716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063018 predicted 439
2 SASI_Hs01_00063019 predicted 1657
3 SASI_Hs01_00063020 predicted 1958
4 SASI_Hs01_00063021 predicted 2009
5 SASI_Hs02_00358945 predicted 415
6 SASI_Hs01_00063022 predicted 316
7 SASI_Hs01_00063023 predicted 995
8 SASI_Hs01_00063024 predicted 1523
9 SASI_Hs01_00063025 predicted 395
10 SASI_Hs01_00063026 predicted 424
11 SASI_Hs01_00063027 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203124 predicted 438
2 SASI_Hs01_00203125 predicted 1752
3 SASI_Hs01_00203126 predicted 2051
4 SASI_Hs01_00203127 predicted 2101
5 SASI_Hs02_00358946 predicted 411
6 SASI_Hs01_00203128 predicted 322
7 SASI_Hs01_00203129 predicted 994
8 SASI_Hs01_00203130 predicted 1620
9 SASI_Hs01_00203131 predicted 399
10 SASI_Hs01_00203132 predicted 426
11 SASI_Hs01_00203133 predicted 1745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093114 predicted 2426
2 SASI_Rn01_00093115 predicted 5333
3 SASI_Rn01_00093116 predicted 1994
4 SASI_Rn02_00260812 predicted 5475
5 SASI_Rn01_00093117 predicted 5223
6 SASI_Rn01_00093118 predicted 3497
7 SASI_Rn01_00093120 predicted 1421
8 SASI_Rn02_00260813 predicted 2806
9 SASI_Rn01_00093121 predicted 2227
10 SASI_Rn01_00093122 predicted 1544
11 SASI_Rn01_00093119 predicted 4207
12 SASI_Rn01_00093123 predicted 5175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199023 predicted 2006
2 SASI_Mm01_00199024 predicted 950
3 SASI_Mm01_00199025 predicted 577
4 SASI_Mm01_00199026 predicted 1112
5 SASI_Mm01_00199027 predicted 641
6 SASI_Mm01_00199028 predicted 1052
7 SASI_Mm01_00199029 predicted 2006
8 SASI_Mm02_00290242 predicted 2021
9 SASI_Mm01_00199032 predicted 1932
10 SASI_Mm02_00290243 predicted 1110
11 SASI_Mm01_00199030 predicted 1070
12 SASI_Mm01_00199031 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060220 predicted 1919
2 SASI_Mm01_00060221 predicted 946
3 SASI_Mm01_00060222 predicted 577
4 SASI_Mm01_00060223 predicted 1109
5 SASI_Mm01_00060224 predicted 638
6 SASI_Mm01_00060225 predicted 1051
7 SASI_Mm01_00060226 predicted 1917
8 SASI_Mm02_00314349 predicted 1929
9 SASI_Mm01_00060229 predicted 1835
10 SASI_Mm02_00314350 predicted 1117
11 SASI_Mm01_00060227 predicted 1068
12 SASI_Mm01_00060228 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233857 predicted 823
2 SASI_Mm01_00233858 predicted 787
3 SASI_Mm01_00233859 predicted 730
4 SASI_Mm01_00233860 predicted 711
5 SASI_Mm01_00233861 predicted 790
6 SASI_Mm01_00233862 predicted 664
7 SASI_Mm01_00233863 predicted 782
8 SASI_Mm01_00233864 predicted 665
9 SASI_Mm01_00233865 predicted 724
10 SASI_Mm01_00233866 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278230 predicted 2316
2 SASI_Mm01_00278231 predicted 2435
3 SASI_Mm01_00278232 predicted 2549
4 SASI_Mm01_00278233 predicted 2547
5 SASI_Mm01_00278234 predicted 2738
6 SASI_Mm01_00278235 predicted 2603
7 SASI_Mm01_00278236 predicted 2368
8 SASI_Mm01_00278237 predicted 2136
9 SASI_Mm01_00278238 predicted 2644
10 SASI_Mm01_00278239 predicted 2453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271446 predicted 2028
2 SASI_Mm01_00271447 predicted 1138
3 SASI_Mm01_00271448 predicted 2464
4 SASI_Mm01_00271449 predicted 2319
5 SASI_Mm01_00271450 predicted 2035
6 SASI_Mm01_00271451 predicted 1091
7 SASI_Mm01_00271452 predicted 2076
8 SASI_Mm01_00271453 predicted 2364
9 SASI_Mm01_00271454 predicted 2173
10 SASI_Mm01_00271455 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227791 predicted 2156
2 SASI_Mm01_00227792 predicted 1257
3 SASI_Mm01_00227793 predicted 2585
4 SASI_Mm01_00227794 predicted 2446
5 SASI_Mm01_00227795 predicted 2152
6 SASI_Mm01_00227796 predicted 1219
7 SASI_Mm01_00227797 predicted 2206
8 SASI_Mm01_00227798 predicted 2491
9 SASI_Mm01_00227799 predicted 2298
10 SASI_Mm01_00227800 predicted 2082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251675 predicted 1624
2 SASI_Mm01_00251676 predicted 819
3 SASI_Mm01_00251677 predicted 2043
4 SASI_Mm01_00251678 predicted 1905
5 SASI_Mm01_00251679 predicted 1617
6 SASI_Mm01_00251680 predicted 766
7 SASI_Mm01_00251681 predicted 1670
8 SASI_Mm01_00251682 predicted 1952
9 SASI_Mm01_00251683 predicted 1765
10 SASI_Mm01_00251684 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262563 predicted 1587
2 SASI_Mm01_00262564 predicted 782
3 SASI_Mm01_00262565 predicted 2016
4 SASI_Mm01_00262566 predicted 1871
5 SASI_Mm01_00262567 predicted 1584
6 SASI_Mm01_00262568 predicted 730
7 SASI_Mm01_00262569 predicted 1630
8 SASI_Mm01_00262570 predicted 1921
9 SASI_Mm01_00262571 predicted 1719
10 SASI_Mm01_00262572 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239991 predicted 6371
2 SASI_Mm01_00239992 predicted 6476
3 SASI_Mm01_00239993 predicted 6468
4 SASI_Mm01_00239994 predicted 5338
5 SASI_Mm01_00239995 predicted 6674
6 SASI_Mm01_00239996 predicted 6535
7 SASI_Mm01_00239997 predicted 6295
8 SASI_Mm01_00239998 predicted 6580
9 SASI_Mm01_00239999 predicted 6379
10 SASI_Mm01_00240000 predicted 6165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280654 predicted 5578
2 SASI_Mm01_00280655 predicted 5688
3 SASI_Mm01_00280656 predicted 5681
4 SASI_Mm01_00280657 predicted 4647
5 SASI_Mm01_00280658 predicted 5887
6 SASI_Mm01_00280659 predicted 5742
7 SASI_Mm01_00280660 predicted 5505
8 SASI_Mm01_00280661 predicted 5783
9 SASI_Mm01_00280662 predicted 5591
10 SASI_Mm01_00280663 predicted 5371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209573 predicted 6437
2 SASI_Mm01_00209574 predicted 6555
3 SASI_Mm01_00209575 predicted 6547
4 SASI_Mm01_00209576 predicted 5508
5 SASI_Mm01_00209577 predicted 6744
6 SASI_Mm01_00209578 predicted 6609
7 SASI_Mm01_00209579 predicted 6366
8 SASI_Mm01_00209580 predicted 6651
9 SASI_Mm01_00209581 predicted 6451
10 SASI_Mm01_00209582 predicted 6236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256339 predicted 6271
2 SASI_Mm01_00256340 predicted 6387
3 SASI_Mm01_00256341 predicted 6372
4 SASI_Mm01_00256342 predicted 5340
5 SASI_Mm01_00256343 predicted 6573
6 SASI_Mm01_00256344 predicted 6436
7 SASI_Mm01_00256345 predicted 6201
8 SASI_Mm01_00256346 predicted 6478
9 SASI_Mm01_00256347 predicted 6287
10 SASI_Mm01_00256348 predicted 6074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008632
MAP2 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2149s21c1
Sequence:CCGGGTGCCTGAAGGCTATCCAATACTCGAGTATTGGATAGCCTTCAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2062s21c1
Sequence:CCGGTGGATACAATCGGACAATTATCTCGAGATAATTGTCCGATTGTATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-1400s21c1
Sequence:CCGGGATCAACTGACAACATCAAATCTCGAGATTTGATGTTGTCAGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-629s21c1
Sequence:CCGGACAGGTCACAGGGCACCTATTCTCGAGAATAGGTGCCCTGTGACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-4434s1c1
Sequence:CCGGGCAGTTAGAAACTATTCCTAACTCGAGTTAGGAATAGTTTCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-523s1c1
Sequence:CCGGGCAGTCCTGAAAGGAGAACAACTCGAGTTGTTCTCCTTTCAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-5185s1c1
Sequence:CCGGCCTAAGCAGCTTCGGCTTATTCTCGAGAATAAGCCGAAGCTGCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008632.1-5709s1c1
Sequence:CCGGCCTTTAGCACTGGAGTAACATCTCGAGATGTTACTCCAGTGCTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-2012s1c1
Sequence:CCGGCCCAGGAATCTCTTGATACTACTCGAGTAGTATCAAGAGATTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008632
MAP2 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2149s21c1
Sequence:CCGGGTGCCTGAAGGCTATCCAATACTCGAGTATTGGATAGCCTTCAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2062s21c1
Sequence:CCGGTGGATACAATCGGACAATTATCTCGAGATAATTGTCCGATTGTATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-1400s21c1
Sequence:CCGGGATCAACTGACAACATCAAATCTCGAGATTTGATGTTGTCAGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-629s21c1
Sequence:CCGGACAGGTCACAGGGCACCTATTCTCGAGAATAGGTGCCCTGTGACCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-4434s1c1
Sequence:CCGGGCAGTTAGAAACTATTCCTAACTCGAGTTAGGAATAGTTTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-523s1c1
Sequence:CCGGGCAGTCCTGAAAGGAGAACAACTCGAGTTGTTCTCCTTTCAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-5185s1c1
Sequence:CCGGCCTAAGCAGCTTCGGCTTATTCTCGAGAATAAGCCGAAGCTGCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008632.1-5709s1c1
Sequence:CCGGCCTTTAGCACTGGAGTAACATCTCGAGATGTTACTCCAGTGCTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-2012s1c1
Sequence:CCGGCCCAGGAATCTCTTGATACTACTCGAGTAGTATCAAGAGATTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008632
MAP2 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2149s21c1
Sequence:CCGGGTGCCTGAAGGCTATCCAATACTCGAGTATTGGATAGCCTTCAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008632.2-2062s21c1
Sequence:CCGGTGGATACAATCGGACAATTATCTCGAGATAATTGTCCGATTGTATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-1400s21c1
Sequence:CCGGGATCAACTGACAACATCAAATCTCGAGATTTGATGTTGTCAGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008632.2-629s21c1
Sequence:CCGGACAGGTCACAGGGCACCTATTCTCGAGAATAGGTGCCCTGTGACCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-4434s1c1
Sequence:CCGGGCAGTTAGAAACTATTCCTAACTCGAGTTAGGAATAGTTTCTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-523s1c1
Sequence:CCGGGCAGTCCTGAAAGGAGAACAACTCGAGTTGTTCTCCTTTCAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-5185s1c1
Sequence:CCGGCCTAAGCAGCTTCGGCTTATTCTCGAGAATAAGCCGAAGCTGCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008632.1-5709s1c1
Sequence:CCGGCCTTTAGCACTGGAGTAACATCTCGAGATGTTACTCCAGTGCTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008632.1-2012s1c1
Sequence:CCGGCCCAGGAATCTCTTGATACTACTCGAGTAGTATCAAGAGATTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002374
MAP2 MISSION shRNA Bacterial Glycerol Stock
microtubule-associated protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-4823s21c1
Sequence:CCGGCAAAGTCTCTGACGGAGTAACCTCGAGGTTACTCCGTCAGAGACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-1811s21c1
Sequence:CCGGGACCGAACCATCTGCATTAATCTCGAGATTAATGCAGATGGTTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-2936s21c1
Sequence:CCGGTTACGAAGGCACTGATGATAACTCGAGTTATCATCAGTGCCTTCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002374.2-5848s1c1
Sequence:CCGGCCCAAACTGTAGTAATTGTTACTCGAGTAACAATTACTACAGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3745s1c1
Sequence:CCGGCCGTCAAATTGTCAGTGGAAACTCGAGTTTCCACTGACAATTTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-330s1c1
Sequence:CCGGCCACCTGAGATTAAGGATCAACTCGAGTTGATCCTTAATCTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-2434s1c1
Sequence:CCGGCCGATATTCTAACCAACACTACTCGAGTAGTGTTGGTTAGAATATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3746s1c1
Sequence:CCGGCGTCAAATTGTCAGTGGAAATCTCGAGATTTCCACTGACAATTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002374
MAP2 MISSION shRNA shRNA Plasmid DNA
microtubule-associated protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-4823s21c1
Sequence:CCGGCAAAGTCTCTGACGGAGTAACCTCGAGGTTACTCCGTCAGAGACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-1811s21c1
Sequence:CCGGGACCGAACCATCTGCATTAATCTCGAGATTAATGCAGATGGTTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-2936s21c1
Sequence:CCGGTTACGAAGGCACTGATGATAACTCGAGTTATCATCAGTGCCTTCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002374.2-5848s1c1
Sequence:CCGGCCCAAACTGTAGTAATTGTTACTCGAGTAACAATTACTACAGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3745s1c1
Sequence:CCGGCCGTCAAATTGTCAGTGGAAACTCGAGTTTCCACTGACAATTTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-330s1c1
Sequence:CCGGCCACCTGAGATTAAGGATCAACTCGAGTTGATCCTTAATCTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-2434s1c1
Sequence:CCGGCCGATATTCTAACCAACACTACTCGAGTAGTGTTGGTTAGAATATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3746s1c1
Sequence:CCGGCGTCAAATTGTCAGTGGAAATCTCGAGATTTCCACTGACAATTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002374
MAP2 MISSION shRNA Lentiviral Transduction Particles
microtubule-associated protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-4823s21c1
Sequence:CCGGCAAAGTCTCTGACGGAGTAACCTCGAGGTTACTCCGTCAGAGACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-1811s21c1
Sequence:CCGGGACCGAACCATCTGCATTAATCTCGAGATTAATGCAGATGGTTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002374.3-2936s21c1
Sequence:CCGGTTACGAAGGCACTGATGATAACTCGAGTTATCATCAGTGCCTTCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002374.2-5848s1c1
Sequence:CCGGCCCAAACTGTAGTAATTGTTACTCGAGTAACAATTACTACAGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3745s1c1
Sequence:CCGGCCGTCAAATTGTCAGTGGAAACTCGAGTTTCCACTGACAATTTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-330s1c1
Sequence:CCGGCCACCTGAGATTAAGGATCAACTCGAGTTGATCCTTAATCTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-2434s1c1
Sequence:CCGGCCGATATTCTAACCAACACTACTCGAGTAGTGTTGGTTAGAATATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002374.2-3746s1c1
Sequence:CCGGCGTCAAATTGTCAGTGGAAATCTCGAGATTTCCACTGACAATTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)