EMAIL THIS PAGE TO A FRIEND

MAP2K1

mitogen-activated protein kinase kinase 1

194 Gene Product Result for
Synonyms: CFC3 MAPKK1 MEK1 MKK1 PRKMK1
UniProtKB ID: Q02750
Gene ID:
Human(5604) Summary: The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008]
Mouse(26395) mitogen-activated protein kinase kinase 1
Rat(170851) mitogen activated protein kinase kinase 1
Zebrafish(406728) mitogen-activated protein kinase kinase 1
chicken(415549) mitogen-activated protein kinase kinase 1
dog(478347) mitogen-activated protein kinase kinase 1
Horse(100065996) mitogen-activated protein kinase kinase 1
cow(533199) mitogen-activated protein kinase kinase 1
domestic cat(101081387) mitogen-activated protein kinase kinase 1
sheep(101123635) mitogen-activated protein kinase kinase 1
naked mole-rat(101715628) mitogen-activated protein kinase kinase 1
Domestic Rabbit(100009316) mitogen-activated protein kinase kinase 1
domestic guinea pig(100712888) mitogen-activated protein kinase kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305626 ANTI-BI-PHOSPHO-MEK1(S218/222) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
M5795 Anti-MAP Kinase Kinase (MEK, MAPKK) antibody produced in rabbit whole antiserum rat, mouse, human
microarray, western blot pricing
SAB4300439 Anti-MAP2K1 (Ab-221) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4300537 Anti-MAP2K1 (Ab-291) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
GW21068 Anti-MAP2K1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
HPA026430 Anti-MAP2K1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107602 Anti-MAP2K1 antibody produced in rabbit affinity isolated antibody human, horse, goat, mouse, bovine, guinea pig, rabbit, rat
western blot pricing
SAB4300463 Anti-MAP2K1/MAP2K2 (Ab-217/221) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306051 ANTI-MEK1 (MAP2K1) (S218) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306694 ANTI-MEK1 (MAP2K1)(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502404 Anti-MEK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502405 Anti-MEK1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4502406 Anti-MEK1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4502407 Anti-MEK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502408 Anti-MEK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300132 Anti-phospho-MAP2K1 (pSer221) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300234 Anti-phospho-MAP2K1 (pThr291) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4504620 Anti-phospho-MAP2K1 (pThr386) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4300165 Anti-phospho-MAP2K1/MAP2K2 (pSer217/pSer221) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4504038 Anti-phospho-MEK1 (pSer298) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504039 Anti-phospho-MEK1 (pThr286) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504468 Anti-phospho-MEK1 (pThr291) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
M2943 Anti-phospho-MEK1 (pThr292) from rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
western blot pricing
SAB1306660 ANTI-PHOSPHO-MEK1(S222) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4504466 Anti-phospho-MEK1/2 (pSer217) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504467 Anti-phospho-MEK1/2 (pSer221) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0005604M1 Monoclonal Anti-MAP2K1 antibody produced in mouse clone 1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100573 Monoclonal Anti-MAP2K1 antibody produced in mouse clone MAP2K1-A545, culture supernatant human
western blot pricing
PLA0242 Rabbit anti-MEK1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, rat, primate, rhesus monkey, bovine, pig, dog, mouse, rabbit, guinea pig, gorilla
immunoprecipitation (IP), proximity ligation assay, western blot pricing
PLA0285 Rabbit anti-Phospho MEK1(T286) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, immunoprecipitation (IP), proximity ligation assay pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing
U120 U0126 monoethanolate ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002755 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002755 Rosetta Predictions human pricing
NM_031643 Rosetta Predictions rat pricing
NM_008927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090167 predicted 853
2 SASI_Hs01_00090168 predicted 978
3 SASI_Hs01_00090169 predicted 1556
4 SASI_Hs01_00090170 predicted 2107
5 SASI_Hs01_00090171 predicted 1534
6 SASI_Hs01_00090172 predicted 1521
7 SASI_Hs01_00090173 predicted 763
8 SASI_Hs02_00334372 predicted 948
9 SASI_Hs01_00090174 predicted 710
10 SASI_Hs02_00334373 predicted 755
11 SASI_Hs01_00090175 predicted 1662
12 SASI_Hs01_00090176 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033908 predicted 663
2 SASI_Rn01_00033909 predicted 564
3 SASI_Rn01_00033910 predicted 319
4 SASI_Rn01_00033911 predicted 699
5 SASI_Rn01_00033912 predicted 979
6 SASI_Rn01_00033914 predicted 1092
7 SASI_Rn01_00033915 predicted 296
8 SASI_Rn01_00033916 predicted 1007
9 SASI_Rn01_00033917 predicted 393
10 SASI_Rn02_00264951 predicted 844
11 SASI_Rn01_00033913 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127412 predicted 955
2 SASI_Mm02_00314959 predicted 1494
3 SASI_Mm01_00127413 predicted 814
4 SASI_Mm01_00127414 predicted 915
5 SASI_Mm01_00127415 predicted 1372
6 SASI_Mm01_00127416 predicted 1125
7 SASI_Mm01_00127417 predicted 873
8 SASI_Mm02_00314960 predicted 990
9 SASI_Mm01_00127420 predicted 1264
10 SASI_Mm01_00127421 predicted 1537
11 SASI_Mm01_00127418 predicted 1054
12 SASI_Mm01_00127419 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008927
VALIDATED
MAP2K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-1439s21c1
Sequence:CCGGTGCTCCACCATTGGGCTTAACCTCGAGGTTAAGCCCAATGGTGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-616s1c1
Sequence:CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-1021s1c1
Sequence:CCGGTGGAGTATTCAGTCTGGAGTTCTCGAGAACTCCAGACTGAATACTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-340s1c1
Sequence:CCGGCCTGGAGATCAAACCCGCAATCTCGAGATTGCGGGTTTGATCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-1099s1c1
Sequence:CCGGGCAGCTCATGGTACATGCTTTCTCGAGAAAGCATGTACCATGAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1965s21c1
Sequence:CCGGGAACGTGTACGTCATGGTATTCTCGAGAATACCATGACGTACACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1556s21c1
Sequence:CCGGCCTCTCCCATGCTTGTCTATGCTCGAGCATAGACAAGCATGGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-574s21c1
Sequence:CCGGCAAGCCATCTGGCCTGGTTATCTCGAGATAACCAGGCCAGATGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008927
VALIDATED
MAP2K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-1439s21c1
Sequence:CCGGTGCTCCACCATTGGGCTTAACCTCGAGGTTAAGCCCAATGGTGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-616s1c1
Sequence:CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-1021s1c1
Sequence:CCGGTGGAGTATTCAGTCTGGAGTTCTCGAGAACTCCAGACTGAATACTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-340s1c1
Sequence:CCGGCCTGGAGATCAAACCCGCAATCTCGAGATTGCGGGTTTGATCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-1099s1c1
Sequence:CCGGGCAGCTCATGGTACATGCTTTCTCGAGAAAGCATGTACCATGAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1965s21c1
Sequence:CCGGGAACGTGTACGTCATGGTATTCTCGAGAATACCATGACGTACACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1556s21c1
Sequence:CCGGCCTCTCCCATGCTTGTCTATGCTCGAGCATAGACAAGCATGGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-574s21c1
Sequence:CCGGCAAGCCATCTGGCCTGGTTATCTCGAGATAACCAGGCCAGATGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008927
VALIDATED
MAP2K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-1439s21c1
Sequence:CCGGTGCTCCACCATTGGGCTTAACCTCGAGGTTAAGCCCAATGGTGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-616s1c1
Sequence:CCGGGCCATCCAACATTCTAGTGAACTCGAGTTCACTAGAATGTTGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008927.1-1021s1c1
Sequence:CCGGTGGAGTATTCAGTCTGGAGTTCTCGAGAACTCCAGACTGAATACTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-340s1c1
Sequence:CCGGCCTGGAGATCAAACCCGCAATCTCGAGATTGCGGGTTTGATCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008927.1-1099s1c1
Sequence:CCGGGCAGCTCATGGTACATGCTTTCTCGAGAAAGCATGTACCATGAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1965s21c1
Sequence:CCGGGAACGTGTACGTCATGGTATTCTCGAGAATACCATGACGTACACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008927.3-1556s21c1
Sequence:CCGGCCTCTCCCATGCTTGTCTATGCTCGAGCATAGACAAGCATGGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008927.3-574s21c1
Sequence:CCGGCAAGCCATCTGGCCTGGTTATCTCGAGATAACCAGGCCAGATGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002755
VALIDATED
MAP2K1 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-858s21c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.2-2032s1c1
Sequence:CCGGCCCATATCCAAGTACCAATGCCTCGAGGCATTGGTACTTGGATATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-753s1c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-373s1c1
Sequence:CCGGCTGGAGATCAAACCCGCAATCCTCGAGGATTGCGGGTTTGATCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-2023s1c1
Sequence:CCGGTTGACATTTGGTGGTACTTTACTCGAGTAAAGTACCACCAAATGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-979s1c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-752s1c1
Sequence:CCGGGTCATGGCCAGAAAGCTAATTCTCGAGAATTAGCTTTCTGGCCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-979s21c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-1156s21c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-1163s1c1
Sequence:CCGGCTGATGCTGAGGAAGTGGATTCTCGAGAATCCACTTCCTCAGCATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002755.x-612s1c1
Sequence:CCGGGAGGGAGAAGCACAAGATCATCTCGAGATGATCTTGTGCTTCTCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.x-1612s1c1
Sequence:CCGGCGGACTTTGACATTTGACATTCTCGAGAATGTCAAATGTCAAAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002755.x-1015s1c1
Sequence:CCGGGATTACATAGTCAACGAGCCTCTCGAGAGGCTCGTTGACTATGTAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-455s1c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002755
VALIDATED
MAP2K1 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-858s21c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.2-2032s1c1
Sequence:CCGGCCCATATCCAAGTACCAATGCCTCGAGGCATTGGTACTTGGATATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-753s1c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-373s1c1
Sequence:CCGGCTGGAGATCAAACCCGCAATCCTCGAGGATTGCGGGTTTGATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-2023s1c1
Sequence:CCGGTTGACATTTGGTGGTACTTTACTCGAGTAAAGTACCACCAAATGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-979s1c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-752s1c1
Sequence:CCGGGTCATGGCCAGAAAGCTAATTCTCGAGAATTAGCTTTCTGGCCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-979s21c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-1156s21c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-1163s1c1
Sequence:CCGGCTGATGCTGAGGAAGTGGATTCTCGAGAATCCACTTCCTCAGCATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002755.x-612s1c1
Sequence:CCGGGAGGGAGAAGCACAAGATCATCTCGAGATGATCTTGTGCTTCTCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.x-1612s1c1
Sequence:CCGGCGGACTTTGACATTTGACATTCTCGAGAATGTCAAATGTCAAAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002755.x-1015s1c1
Sequence:CCGGGATTACATAGTCAACGAGCCTCTCGAGAGGCTCGTTGACTATGTAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-455s1c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002755
VALIDATED
MAP2K1 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-858s21c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.2-2032s1c1
Sequence:CCGGCCCATATCCAAGTACCAATGCCTCGAGGCATTGGTACTTGGATATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-753s1c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.2-373s1c1
Sequence:CCGGCTGGAGATCAAACCCGCAATCCTCGAGGATTGCGGGTTTGATCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-2023s1c1
Sequence:CCGGTTGACATTTGGTGGTACTTTACTCGAGTAAAGTACCACCAAATGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-979s1c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.3-752s1c1
Sequence:CCGGGTCATGGCCAGAAAGCTAATTCTCGAGAATTAGCTTTCTGGCCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-979s21c1
Sequence:CCGGAGTTAGCATTGCTGTAATAAACTCGAGTTTATTACAGCAATGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002755.3-1156s21c1
Sequence:CCGGGTCCTACATGTCGCCAGAAAGCTCGAGCTTTCTGGCGACATGTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-1163s1c1
Sequence:CCGGCTGATGCTGAGGAAGTGGATTCTCGAGAATCCACTTCCTCAGCATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002755.x-612s1c1
Sequence:CCGGGAGGGAGAAGCACAAGATCATCTCGAGATGATCTTGTGCTTCTCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002755.x-1612s1c1
Sequence:CCGGCGGACTTTGACATTTGACATTCTCGAGAATGTCAAATGTCAAAGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002755.x-1015s1c1
Sequence:CCGGGATTACATAGTCAACGAGCCTCTCGAGAGGCTCGTTGACTATGTAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002755.x-455s1c1
Sequence:CCGGGCTTCTATGGTGCGTTCTACACTCGAGTGTAGAACGCACCATAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)