EMAIL THIS PAGE TO A FRIEND

MAP2K2

mitogen-activated protein kinase kinase 2

76 Gene Product Result for
Synonyms: CFC4 MAPKK2 MEK2 MKK2 PRKMK2
UniProtKB ID: P36507
Gene ID:
Human(5605) Summary: The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(26396) mitogen-activated protein kinase kinase 2
Rat(58960) mitogen activated protein kinase kinase 2
chicken(396349) mitogen-activated protein kinase kinase 2
dog(611939) mitogen-activated protein kinase kinase 2
cow(510434) mitogen-activated protein kinase kinase 2
domestic guinea pig(100728923) mitogen-activated protein kinase kinase 2
naked mole-rat(101707562) mitogen-activated protein kinase kinase 2
sheep(101113846) mitogen-activated protein kinase kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M5795 Anti-MAP Kinase Kinase (MEK, MAPKK) antibody produced in rabbit whole antiserum rat, mouse, human
microarray, western blot pricing
SAB4300463 Anti-MAP2K1/MAP2K2 (Ab-217/221) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300293 Anti-MAP2K2 (Ab-394) antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
SAB1406302 Anti-MAP2K2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV48942 Anti-MAP2K2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2101426 Anti-MAP2K2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
HPA051993 Anti-MAP2K2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306613 ANTI-MEK2 (MAP2K2) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1304645 ANTI-MOUSE MAP2K2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4300165 Anti-phospho-MAP2K1/MAP2K2 (pSer217/pSer221) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4300007 Anti-phospho-MAP2K2 (pThr394) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504466 Anti-phospho-MEK1/2 (pSer217) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504467 Anti-phospho-MEK1/2 (pSer221) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504469 Anti-phospho-MEK2 (pThr394) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB5300055 Monoclonal Anti-MAP2K2 antibody produced in mouse clone 7F5, ascites fluid human, rat, mouse
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB2702302 Monoclonal Anti-MEK2 antibody produced in mouse clone GT1162, affinity isolated antibody human
western blot pricing
SAB2702303 Monoclonal Anti-MEK2 antibody produced in mouse clone GT1721, affinity isolated antibody human
western blot pricing
SAB2702304 Monoclonal Anti-MEK2 antibody produced in mouse clone GT3522, affinity isolated antibody human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing
U120 U0126 monoethanolate ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011371 MISSION® esiRNA esiRNA targeting mouse Map2k2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030662 siRNAs that have been validated in the lab human pricing
NM_133283 Rosetta Predictions rat pricing
NM_023138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030662 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109852 validated 1189
2 SASI_Hs01_00109853 predicted 682
3 SASI_Hs01_00109855 predicted 614
4 SASI_Hs01_00109856 predicted 674
5 SASI_Hs01_00109857 predicted 1196
6 SASI_Hs01_00109854 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267549 predicted 294
2 SASI_Rn01_00075550 predicted 1118
3 SASI_Rn01_00075551 predicted 826
4 SASI_Rn01_00075552 predicted 613
5 SASI_Rn02_00267550 predicted 1095
6 SASI_Rn01_00075553 predicted 582
7 SASI_Rn01_00075555 predicted 1028
8 SASI_Rn01_00075556 predicted 530
9 SASI_Rn01_00075557 predicted 590
10 SASI_Rn01_00075558 predicted 663
11 SASI_Rn01_00075554 predicted 312
12 SASI_Rn01_00075559 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092174 predicted 846
2 SASI_Mm02_00326856 predicted 1804
3 SASI_Mm01_00092175 predicted 217
4 SASI_Mm01_00092176 predicted 1005
5 SASI_Mm01_00092177 predicted 853
6 SASI_Mm01_00092178 predicted 689
7 SASI_Mm02_00326857 predicted 215
8 SASI_Mm01_00092179 predicted 641
9 SASI_Mm01_00092180 predicted 1201
10 SASI_Mm01_00092182 predicted 1206
11 SASI_Mm01_00092181 predicted 485
12 SASI_Mm01_00092183 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030662
VALIDATED
MAP2K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1219s1c1
Sequence:CCGGTGGACTATATTGTGAACGAGCCTCGAGGCTCGTTCACAATATAGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1277s1c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-1370s1c1
Sequence:CCGGCGAGGTGGAAGAAGTGGATTTCTCGAGAAATCCACTTCTTCCACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030662.2-848s1c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-449s21c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-848s21c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-623s21c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-1277s21c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-449s1c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-685s1c1
Sequence:CCGGGCATTTGCATGGAACACATGGCTCGAGCCATGTGTTCCATGCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1518s1c1
Sequence:CCGGCCCTTCCAGCTGAGGACAGGCCTCGAGGCCTGTCCTCAGCTGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1593s1c1
Sequence:CCGGCGACAGCGCATGCAGGAACGGCTCGAGCCGTTCCTGCATGCGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-623s1c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030662
VALIDATED
MAP2K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1219s1c1
Sequence:CCGGTGGACTATATTGTGAACGAGCCTCGAGGCTCGTTCACAATATAGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1277s1c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-1370s1c1
Sequence:CCGGCGAGGTGGAAGAAGTGGATTTCTCGAGAAATCCACTTCTTCCACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030662.2-848s1c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-449s21c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-848s21c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-623s21c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-1277s21c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-449s1c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-685s1c1
Sequence:CCGGGCATTTGCATGGAACACATGGCTCGAGCCATGTGTTCCATGCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1518s1c1
Sequence:CCGGCCCTTCCAGCTGAGGACAGGCCTCGAGGCCTGTCCTCAGCTGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1593s1c1
Sequence:CCGGCGACAGCGCATGCAGGAACGGCTCGAGCCGTTCCTGCATGCGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-623s1c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030662
VALIDATED
MAP2K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1219s1c1
Sequence:CCGGTGGACTATATTGTGAACGAGCCTCGAGGCTCGTTCACAATATAGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-1277s1c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-1370s1c1
Sequence:CCGGCGAGGTGGAAGAAGTGGATTTCTCGAGAAATCCACTTCTTCCACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030662.2-848s1c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-449s21c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-848s21c1
Sequence:CCGGCAACATCCTCGTGAACTCTAGCTCGAGCTAGAGTTCACGAGGATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-623s21c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030662.3-1277s21c1
Sequence:CCGGCTTCCAGGAGTTTGTCAATAACTCGAGTTATTGACAAACTCCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-449s1c1
Sequence:CCGGCGAACTCAAAGACGATGACTTCTCGAGAAGTCATCGTCTTTGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030662.2-685s1c1
Sequence:CCGGGCATTTGCATGGAACACATGGCTCGAGCCATGTGTTCCATGCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1518s1c1
Sequence:CCGGCCCTTCCAGCTGAGGACAGGCCTCGAGGCCTGTCCTCAGCTGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030662.2-1593s1c1
Sequence:CCGGCGACAGCGCATGCAGGAACGGCTCGAGCCGTTCCTGCATGCGCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030662.2-623s1c1
Sequence:CCGGCGAATGCAACTCGCCGTACATCTCGAGATGTACGGCGAGTTGCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023138
MAP2K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1243s1c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1163s21c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1180s1c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1303s1c1
Sequence:CCGGGCTGCTGATGAACCACGCCTTCTCGAGAAGGCGTGGTTCATCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-703s1c1
Sequence:CCGGCAAGCGGATTCCTGAAGACATCTCGAGATGTCTTCAGGAATCCGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1022s1c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-766s1c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1129s1c1
Sequence:CCGGCATCAGTGTAGGTCATGGGATCTCGAGATCCCATGACCTACACTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-805s1c1
Sequence:CCGGGCCCTCCAACATCCTGGTGAACTCGAGTTCACCAGGATGTTGGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1226s21c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-427s1c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-385s1c1
Sequence:CCGGCTTCCTTACCCAGAAGGCTAACTCGAGTTAGCCTTCTGGGTAAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1005s21c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-749s21c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-410s21c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023138
MAP2K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1243s1c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1163s21c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1180s1c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1303s1c1
Sequence:CCGGGCTGCTGATGAACCACGCCTTCTCGAGAAGGCGTGGTTCATCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-703s1c1
Sequence:CCGGCAAGCGGATTCCTGAAGACATCTCGAGATGTCTTCAGGAATCCGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1022s1c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-766s1c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1129s1c1
Sequence:CCGGCATCAGTGTAGGTCATGGGATCTCGAGATCCCATGACCTACACTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-805s1c1
Sequence:CCGGGCCCTCCAACATCCTGGTGAACTCGAGTTCACCAGGATGTTGGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1226s21c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-427s1c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-385s1c1
Sequence:CCGGCTTCCTTACCCAGAAGGCTAACTCGAGTTAGCCTTCTGGGTAAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1005s21c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-749s21c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-410s21c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023138
MAP2K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1243s1c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1163s21c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1180s1c1
Sequence:CCGGGCTGCTGGACTACATAGTGAACTCGAGTTCACTATGTAGTCCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1303s1c1
Sequence:CCGGGCTGCTGATGAACCACGCCTTCTCGAGAAGGCGTGGTTCATCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-703s1c1
Sequence:CCGGCAAGCGGATTCCTGAAGACATCTCGAGATGTCTTCAGGAATCCGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1022s1c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-766s1c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-1129s1c1
Sequence:CCGGCATCAGTGTAGGTCATGGGATCTCGAGATCCCATGACCTACACTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-805s1c1
Sequence:CCGGGCCCTCCAACATCCTGGTGAACTCGAGTTCACCAGGATGTTGGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1226s21c1
Sequence:CCGGCTTCCAGGAGTTTGTGAATAACTCGAGTTATTCACAAACTCCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-427s1c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023138.3-385s1c1
Sequence:CCGGCTTCCTTACCCAGAAGGCTAACTCGAGTTAGCCTTCTGGGTAAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-1005s21c1
Sequence:CCGGCCACCTGATGCCAAGGAACTACTCGAGTAGTTCCTTGGCATCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-749s21c1
Sequence:CCGGCCTCCGAGAGAAGCACCAGATCTCGAGATCTGGTGCTTCTCTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023138.4-410s21c1
Sequence:CCGGCGACTTTGAGAGGATCTCAGACTCGAGTCTGAGATCCTCTCAAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)