EMAIL THIS PAGE TO A FRIEND

MAP2K3

mitogen-activated protein kinase kinase 3

110 Gene Product Result for
Synonyms: MAPKK3 MEK3 MKK3 PRKMK3 SAPKK-2 SAPKK2
UniProtKB ID: P46734, B3KSK7, Q99441, Q9UE71, Q9UE72
Gene ID:
Human(5606) Summary: The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(26397) mitogen-activated protein kinase kinase 3
Rat(303200) mitogen activated protein kinase kinase 3
chicken(416496) mitogen-activated protein kinase kinase 3
dog(489547) mitogen-activated protein kinase kinase 3
domestic cat(101082274) mitogen-activated protein kinase kinase 3
Horse(100053481) mitogen-activated protein kinase kinase 3
cow(516039) mitogen-activated protein kinase kinase 3
sheep(101122959) mitogen-activated protein kinase kinase 3
naked mole-rat(101718318) mitogen-activated protein kinase kinase 3
domestic guinea pig(100726100) mitogen-activated protein kinase kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300391 Anti-MAP2K3 (Ab-189) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101427 Anti-MAP2K3 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, mouse, goat, human, rat
immunohistochemistry, western blot pricing
SAB2101428 Anti-MAP2K3 (ab2) antibody produced in rabbit affinity isolated antibody dog, horse, guinea pig, rabbit, human, bovine
immunohistochemistry, western blot pricing
SAB1406303 Anti-MAP2K3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA044497 Anti-MAP2K3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502410 Anti-MAP2K3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4502409 Anti-MKK3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
M7933 Anti-phospho-MAP Kinase Kinase 3/6 (pSer189/207) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunoprecipitation (IP), western blot pricing
SAB4300119 Anti-phospho-MAP2K3 (pSer189) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504622 Anti-phospho-MAP2K3 (pThr222) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301302 Anti-phospho-MAP2K3 (pThr222) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504473 Anti-phospho-MKK3 (pSer189) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
WH0005606M1 Monoclonal Anti-MAP2K3 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404253 Monoclonal Anti-MAP2K3, (N-terminal) antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002756 Rosetta Predictions human pricing
NM_145109 Rosetta Predictions human pricing
NM_145110 Rosetta Predictions human pricing
NM_001100674 Rosetta Predictions rat pricing
XM_239239 Rosetta Predictions rat pricing
NM_008928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228024 predicted 829
2 SASI_Hs01_00228025 predicted 1012
3 SASI_Hs01_00228026 predicted 941
4 SASI_Hs01_00228027 predicted 855
5 SASI_Hs01_00228028 predicted 1030
6 SASI_Hs01_00228029 predicted 599
7 SASI_Hs01_00228030 predicted 1426
8 SASI_Hs01_00228031 predicted 569
9 SASI_Hs01_00228032 predicted 1008
10 SASI_Hs01_00228033 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154894 predicted 842
2 SASI_Hs01_00154895 predicted 1021
3 SASI_Hs01_00154896 predicted 955
4 SASI_Hs01_00154897 predicted 868
5 SASI_Hs01_00154898 predicted 1042
6 SASI_Hs01_00154899 predicted 611
7 SASI_Hs01_00154900 predicted 1443
8 SASI_Hs01_00154901 predicted 583
9 SASI_Hs01_00154902 predicted 1027
10 SASI_Hs01_00154903 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234608 predicted 995
2 SASI_Hs01_00234609 predicted 1181
3 SASI_Hs01_00234610 predicted 1114
4 SASI_Hs01_00234611 predicted 1014
5 SASI_Hs01_00234612 predicted 1194
6 SASI_Hs01_00234613 predicted 768
7 SASI_Hs01_00234614 predicted 1597
8 SASI_Hs01_00234615 predicted 737
9 SASI_Hs01_00234616 predicted 1180
10 SASI_Hs01_00234617 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210288 predicted 514
2 SASI_Rn02_00210289 predicted 221
3 SASI_Rn02_00210290 predicted 742
4 SASI_Rn02_00210291 predicted 236
5 SASI_Rn02_00210292 predicted 884
6 SASI_Rn02_00210293 predicted 1258
7 SASI_Rn02_00210294 predicted 598
8 SASI_Rn02_00210295 predicted 1286
9 SASI_Rn02_00210296 predicted 480
10 SASI_Rn02_00210297 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126390 predicted 580
2 SASI_Rn01_00126391 predicted 280
3 SASI_Rn01_00126392 predicted 295
4 SASI_Rn01_00126393 predicted 949
5 SASI_Rn01_00126394 predicted 1311
6 SASI_Rn01_00126395 predicted 650
7 SASI_Rn01_00126396 predicted 1342
8 SASI_Rn01_00126397 predicted 534
9 SASI_Rn01_00126398 predicted 917
10 SASI_Rn01_00126399 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081897 predicted 1265
2 SASI_Mm01_00081898 predicted 237
3 SASI_Mm01_00081899 predicted 861
4 SASI_Mm01_00081900 predicted 595
5 SASI_Mm01_00081901 predicted 477
6 SASI_Mm01_00081902 predicted 867
7 SASI_Mm01_00081903 predicted 889
8 SASI_Mm02_00314961 predicted 342
9 SASI_Mm01_00081904 predicted 478
10 SASI_Mm01_00081905 predicted 1156
11 SASI_Mm01_00081906 predicted 1282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002756
VALIDATED
MAP2K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-701s21c1
Sequence:CCGGTACCGGAAGGTGCTGGATAAACTCGAGTTTATCCAGCACCTTCCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-700s1c1
Sequence:CCGGCTACCGGAAGGTGCTGGATAACTCGAGTTATCCAGCACCTTCCGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-791s1c1
Sequence:CCGGCACAGCAAGCTGTCGGTGATCCTCGAGGATCACCGACAGCTTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.2-1441s1c1
Sequence:CCGGGCGAGCCATTTGTCCCAAGTGCTCGAGCACTTGGGACAAATGGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1963s1c1
Sequence:CCGGCTTTATGGGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACCCATAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-969s21c1
Sequence:CCGGTGAACCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1659s21c1
Sequence:CCGGGGATGCCATCCAAGTTGTATACTCGAGTATACAACTTGGATGGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1902s1c1
Sequence:CCGGTATCGGTGTCATTCACCTTTCCTCGAGGAAAGGTGAATGACACCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-389s1c1
Sequence:CCGGCGGACCTTCATCACCATTGGACTCGAGTCCAATGGTGATGAAGGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1690s21c1
Sequence:CCGGCTCTCGACTGAATGGACTTTGCTCGAGCAAAGTCCATTCAGTCGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-755s1c1
Sequence:CCGGATTGCTGTGTCTATCGTGCGGCTCGAGCCGCACGATAGACACAGCAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-1036s1c1
Sequence:CCGGCATCCTGCGGTTCCCTTACGACTCGAGTCGTAAGGGAACCGCAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002756.x-826s1c1
Sequence:CCGGGCCCTCCAATGTCCTTATCAACTCGAGTTGATAAGGACATTGGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002756
VALIDATED
MAP2K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-701s21c1
Sequence:CCGGTACCGGAAGGTGCTGGATAAACTCGAGTTTATCCAGCACCTTCCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-700s1c1
Sequence:CCGGCTACCGGAAGGTGCTGGATAACTCGAGTTATCCAGCACCTTCCGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-791s1c1
Sequence:CCGGCACAGCAAGCTGTCGGTGATCCTCGAGGATCACCGACAGCTTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.2-1441s1c1
Sequence:CCGGGCGAGCCATTTGTCCCAAGTGCTCGAGCACTTGGGACAAATGGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1963s1c1
Sequence:CCGGCTTTATGGGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACCCATAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-969s21c1
Sequence:CCGGTGAACCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1659s21c1
Sequence:CCGGGGATGCCATCCAAGTTGTATACTCGAGTATACAACTTGGATGGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1902s1c1
Sequence:CCGGTATCGGTGTCATTCACCTTTCCTCGAGGAAAGGTGAATGACACCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-389s1c1
Sequence:CCGGCGGACCTTCATCACCATTGGACTCGAGTCCAATGGTGATGAAGGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1690s21c1
Sequence:CCGGCTCTCGACTGAATGGACTTTGCTCGAGCAAAGTCCATTCAGTCGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-755s1c1
Sequence:CCGGATTGCTGTGTCTATCGTGCGGCTCGAGCCGCACGATAGACACAGCAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-1036s1c1
Sequence:CCGGCATCCTGCGGTTCCCTTACGACTCGAGTCGTAAGGGAACCGCAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002756.x-826s1c1
Sequence:CCGGGCCCTCCAATGTCCTTATCAACTCGAGTTGATAAGGACATTGGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002756
VALIDATED
MAP2K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-701s21c1
Sequence:CCGGTACCGGAAGGTGCTGGATAAACTCGAGTTTATCCAGCACCTTCCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-700s1c1
Sequence:CCGGCTACCGGAAGGTGCTGGATAACTCGAGTTATCCAGCACCTTCCGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.2-791s1c1
Sequence:CCGGCACAGCAAGCTGTCGGTGATCCTCGAGGATCACCGACAGCTTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.2-1441s1c1
Sequence:CCGGGCGAGCCATTTGTCCCAAGTGCTCGAGCACTTGGGACAAATGGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1963s1c1
Sequence:CCGGCTTTATGGGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACCCATAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002756.3-969s21c1
Sequence:CCGGTGAACCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1659s21c1
Sequence:CCGGGGATGCCATCCAAGTTGTATACTCGAGTATACAACTTGGATGGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002756.3-1902s1c1
Sequence:CCGGTATCGGTGTCATTCACCTTTCCTCGAGGAAAGGTGAATGACACCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-389s1c1
Sequence:CCGGCGGACCTTCATCACCATTGGACTCGAGTCCAATGGTGATGAAGGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002756.3-1690s21c1
Sequence:CCGGCTCTCGACTGAATGGACTTTGCTCGAGCAAAGTCCATTCAGTCGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-755s1c1
Sequence:CCGGATTGCTGTGTCTATCGTGCGGCTCGAGCCGCACGATAGACACAGCAATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002756.x-1036s1c1
Sequence:CCGGCATCCTGCGGTTCCCTTACGACTCGAGTCGTAAGGGAACCGCAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002756.x-826s1c1
Sequence:CCGGGCCCTCCAATGTCCTTATCAACTCGAGTTGATAAGGACATTGGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008928
VALIDATED
MAP2K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-885s21c3
Sequence:CCGGTGAATCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-1132s21c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-772s21c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1564s21c1
Sequence:CCGGGGATGCCATGCAGGTTGTATACTCGAGTATACAACCTGCATGGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1133s1c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-314s1c1
Sequence:CCGGCATCACTATCGGAGACAGAAACTCGAGTTTCTGTCTCCGATAGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1121s1c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-773s1c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1120s21c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008928.1-605s1c1
Sequence:CCGGCCTGGATAAGTTCTACCGGAACTCGAGTTCCGGTAGAACTTATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1265s21c1
Sequence:CCGGAGCACTTACCTACAGCCATAACTCGAGTTATGGCTGTAGGTAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008928
VALIDATED
MAP2K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-885s21c3
Sequence:CCGGTGAATCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-1132s21c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-772s21c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1564s21c1
Sequence:CCGGGGATGCCATGCAGGTTGTATACTCGAGTATACAACCTGCATGGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1133s1c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-314s1c1
Sequence:CCGGCATCACTATCGGAGACAGAAACTCGAGTTTCTGTCTCCGATAGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1121s1c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-773s1c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1120s21c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008928.1-605s1c1
Sequence:CCGGCCTGGATAAGTTCTACCGGAACTCGAGTTCCGGTAGAACTTATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1265s21c1
Sequence:CCGGAGCACTTACCTACAGCCATAACTCGAGTTATGGCTGTAGGTAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008928
VALIDATED
MAP2K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-885s21c3
Sequence:CCGGTGAATCAGAAGGGCTACAATGCTCGAGCATTGTAGCCCTTCTGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008928.4-1132s21c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-772s21c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1564s21c1
Sequence:CCGGGGATGCCATGCAGGTTGTATACTCGAGTATACAACCTGCATGGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1133s1c1
Sequence:CCGGCCCATTCTTCACCTTGCACAACTCGAGTTGTGCAAGGTGAAGAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-314s1c1
Sequence:CCGGCATCACTATCGGAGACAGAAACTCGAGTTTCTGTCTCCGATAGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-1121s1c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008928.1-773s1c1
Sequence:CCGGGCATGTGAAGATGTGCGACTTCTCGAGAAGTCGCACATCTTCACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1120s21c1
Sequence:CCGGGCTGATGGAACACCCATTCTTCTCGAGAAGAATGGGTGTTCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008928.1-605s1c1
Sequence:CCGGCCTGGATAAGTTCTACCGGAACTCGAGTTCCGGTAGAACTTATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008928.4-1265s21c1
Sequence:CCGGAGCACTTACCTACAGCCATAACTCGAGTTATGGCTGTAGGTAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)