EMAIL THIS PAGE TO A FRIEND

MAP2K4

mitogen-activated protein kinase kinase 4

258 Gene Product Result for
Synonyms: JNKK JNKK1 MAPKK4 MEK4 MKK4 PRKMK4 SAPKK-1 SAPKK1 SEK1 SERK1 SKK1
Gene ID:
Human(6416) Summary: This gene encodes a dual specificity protein kinase that belongs to the Ser/Thr protein kinase family. This kinase is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. It has been shown to activate MAPK8/JNK1, MAPK9/JNK2, and MAPK14/p38, but not MAPK1/ERK2 or MAPK3/ERK3. This kinase is phosphorylated, and thus activated by MAP3K1/MEKK. The knockout studies in mice suggested the roles of this kinase in mediating survival signal in T cell development, as well as in the organogenesis of liver. [provided by RefSeq, Jul 2008]
Mouse(26398) mitogen-activated protein kinase kinase 4
Rat(287398) mitogen activated protein kinase kinase 4
domestic guinea pig(100733674) mitogen-activated protein kinase kinase 4
naked mole-rat(101705822) mitogen-activated protein kinase kinase 4
Domestic Rabbit(100344852) mitogen-activated protein kinase kinase 4
sheep(101115045) mitogen-activated protein kinase kinase 4
chicken(417312) mitogen-activated protein kinase kinase 4
dog(489508) mitogen-activated protein kinase kinase 4
cow(526469) mitogen-activated protein kinase kinase 4
Horse(100073094) mitogen-activated protein kinase kinase 4
domestic cat(101086432) mitogen-activated protein kinase kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502743 Anti-JNKK, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
M6071 Anti-MAP2K4 (66-80) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300403 Anti-MAP2K4 (Ab-261) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry pricing
SAB4300404 Anti-MAP2K4 (Ab-80) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB1406426 Anti-MAP2K4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300707 Anti-MAP2K4 antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
HPA060074 Anti-MAP2K4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1306402 ANTI-MEKK4 (MAP2K4) (S257) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
M7433 Anti-phospho-MAP Kinase Kinase 4 (MKK4, SEK, JNKK1) (pThr223) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
western blot pricing
SAB4300144 Anti-phospho-MAP2K4 (pSer80) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300143 Anti-phospho-MAP2K4 (pThr261) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
M4943 Anti-phospho-MEK4 (pSer257/pThr261) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, frog, mouse
western blot pricing
SAB4504532 Anti-phospho-SEK1/MKK4 (pSer80) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504533 Anti-phospho-SEK1/MKK4 (pThr261) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504267 Anti-phospho-SEK1/MKK4/JNKK1 (pSer257) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4502740 Anti-SEK1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502741 Anti-SEK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502742 Anti-SEK1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4100066 Monoclonal Anti-MAP2K4 antibody produced in mouse clone MAP2K4-A57, culture supernatant human
western blot pricing
SAB5300258 Monoclonal Anti-MAP2K4 antibody produced in mouse clone 2D10D8, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300259 Monoclonal Anti-MAP2K4 antibody produced in mouse clone 5H4, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003010 Rosetta Predictions human pricing
NM_001030023 Rosetta Predictions rat pricing
NM_009157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334897 predicted 688
2 SASI_Hs02_00334898 predicted 1049
3 SASI_Hs02_00334899 predicted 657
4 SASI_Hs01_00150195 predicted 1268
5 SASI_Hs02_00334900 predicted 594
6 SASI_Hs02_00334901 predicted 1244
7 SASI_Hs01_00150196 predicted 1170
8 SASI_Hs02_00334902 predicted 1148
9 SASI_Hs02_00334903 predicted 523
10 SASI_Hs02_00334904 predicted 787
11 SASI_Hs01_00150188 predicted 1056
12 SASI_Hs01_00150189 predicted 751
13 SASI_Hs01_00150190 predicted 633
14 SASI_Hs01_00150191 predicted 1085
15 SASI_Hs01_00150192 predicted 783
16 SASI_Hs01_00150193 predicted 1255
17 SASI_Hs01_00150194 predicted 833
18 SASI_Hs01_00150197 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078305 predicted 678
2 SASI_Rn01_00078307 predicted 973
3 SASI_Rn01_00078308 predicted 464
4 SASI_Rn01_00078309 predicted 753
5 SASI_Rn01_00078310 predicted 360
6 SASI_Rn01_00078311 predicted 624
7 SASI_Rn01_00078312 predicted 840
8 SASI_Rn01_00078313 predicted 318
9 SASI_Rn01_00078314 predicted 465
10 SASI_Rn02_00203528 predicted 681
11 SASI_Rn01_00078306 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137284 predicted 732
2 SASI_Mm01_00137286 predicted 283
3 SASI_Mm01_00137287 predicted 894
4 SASI_Mm01_00137288 predicted 1116
5 SASI_Mm01_00137289 predicted 373
6 SASI_Mm01_00137290 predicted 513
7 SASI_Mm01_00137291 predicted 1126
8 SASI_Mm01_00137292 predicted 734
9 SASI_Mm01_00137293 predicted 637
10 SASI_Mm02_00315482 predicted 407
11 SASI_Mm01_00137285 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003010
VALIDATED
MAP2K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 4
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1101s1c1
Sequence:CCGGCAACTTGTGCCTTACGAAGGACTCGAGTCCTTCGTAAGGCACAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1173s1c1
Sequence:CCGGGATGTATGAAGAACGTGCCGTCTCGAGACGGCACGTTCTTCATACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-917s1c1
Sequence:CCGGGATATGATGTCCGCTCTGATGCTCGAGCATCAGAGCGGACATCATATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003010.x-2385s1c1
Sequence:CCGGCCTGTGGTCTATTGTCGCTATCTCGAGATAGCGACAATAGACCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-396s1c1
Sequence:CCGGACGAGGAGCTTATGGTTCTGTCTCGAGACAGAACCATAAGCTCCTCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-3471s1c1
Sequence:CCGGTACATTGTGAGCTCTGGTTATCTCGAGATAACCAGAGCTCACAATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-1247s1c1
Sequence:CCGGGCTCTCCCATGTATGTCGATTCTCGAGAATCGACATACATGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-256s1c1
Sequence:CCGGCCCAATCCTACAGGAGTTCAACTCGAGTTGAACTCCTGTAGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-440s1c1
Sequence:CCGGGTGGGCAAATAATGGCAGTTACTCGAGTAACTGCCATTATTTGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-3471s1c1
Sequence:CCGGACATTGTGAGCTCTGGTTATCCTCGAGGATAACCAGAGCTCACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-502s1c1
Sequence:CCGGCTTCTTATGGATTTGGATGTACTCGAGTACATCCAAATCCATAAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-517s1c1
Sequence:CCGGGATGTAGTAATGCGGAGTAGTCTCGAGACTACTCCGCATTACTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-185s1c1
Sequence:CCGGGTAAACGCAAAGCACTGAAGTCTCGAGACTTCAGTGCTTTGCGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-991s1c1
Sequence:CCGGCCAAAGTGGAATAGTGTATTTCTCGAGAAATACACTATTCCACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-904s1c1
Sequence:CCGGGCATCACGACAAGGATATGATCTCGAGATCATATCCTTGTCGTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-824s1c1
Sequence:CCGGGACAGCTTGTGGACTCTATTGCTCGAGCAATAGAGTCCACAAGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003010
VALIDATED
MAP2K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 4
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1101s1c1
Sequence:CCGGCAACTTGTGCCTTACGAAGGACTCGAGTCCTTCGTAAGGCACAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1173s1c1
Sequence:CCGGGATGTATGAAGAACGTGCCGTCTCGAGACGGCACGTTCTTCATACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-917s1c1
Sequence:CCGGGATATGATGTCCGCTCTGATGCTCGAGCATCAGAGCGGACATCATATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003010.x-2385s1c1
Sequence:CCGGCCTGTGGTCTATTGTCGCTATCTCGAGATAGCGACAATAGACCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-396s1c1
Sequence:CCGGACGAGGAGCTTATGGTTCTGTCTCGAGACAGAACCATAAGCTCCTCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-3471s1c1
Sequence:CCGGTACATTGTGAGCTCTGGTTATCTCGAGATAACCAGAGCTCACAATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-1247s1c1
Sequence:CCGGGCTCTCCCATGTATGTCGATTCTCGAGAATCGACATACATGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-256s1c1
Sequence:CCGGCCCAATCCTACAGGAGTTCAACTCGAGTTGAACTCCTGTAGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-440s1c1
Sequence:CCGGGTGGGCAAATAATGGCAGTTACTCGAGTAACTGCCATTATTTGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-3471s1c1
Sequence:CCGGACATTGTGAGCTCTGGTTATCCTCGAGGATAACCAGAGCTCACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-502s1c1
Sequence:CCGGCTTCTTATGGATTTGGATGTACTCGAGTACATCCAAATCCATAAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-517s1c1
Sequence:CCGGGATGTAGTAATGCGGAGTAGTCTCGAGACTACTCCGCATTACTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-185s1c1
Sequence:CCGGGTAAACGCAAAGCACTGAAGTCTCGAGACTTCAGTGCTTTGCGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-991s1c1
Sequence:CCGGCCAAAGTGGAATAGTGTATTTCTCGAGAAATACACTATTCCACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-904s1c1
Sequence:CCGGGCATCACGACAAGGATATGATCTCGAGATCATATCCTTGTCGTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-824s1c1
Sequence:CCGGGACAGCTTGTGGACTCTATTGCTCGAGCAATAGAGTCCACAAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003010
VALIDATED
MAP2K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 4
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1101s1c1
Sequence:CCGGCAACTTGTGCCTTACGAAGGACTCGAGTCCTTCGTAAGGCACAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-1173s1c1
Sequence:CCGGGATGTATGAAGAACGTGCCGTCTCGAGACGGCACGTTCTTCATACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-917s1c1
Sequence:CCGGGATATGATGTCCGCTCTGATGCTCGAGCATCAGAGCGGACATCATATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003010.x-2385s1c1
Sequence:CCGGCCTGTGGTCTATTGTCGCTATCTCGAGATAGCGACAATAGACCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-396s1c1
Sequence:CCGGACGAGGAGCTTATGGTTCTGTCTCGAGACAGAACCATAAGCTCCTCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010496    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-3471s1c1
Sequence:CCGGTACATTGTGAGCTCTGGTTATCTCGAGATAACCAGAGCTCACAATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-1247s1c1
Sequence:CCGGGCTCTCCCATGTATGTCGATTCTCGAGAATCGACATACATGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-256s1c1
Sequence:CCGGCCCAATCCTACAGGAGTTCAACTCGAGTTGAACTCCTGTAGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-440s1c1
Sequence:CCGGGTGGGCAAATAATGGCAGTTACTCGAGTAACTGCCATTATTTGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-3471s1c1
Sequence:CCGGACATTGTGAGCTCTGGTTATCCTCGAGGATAACCAGAGCTCACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.x-502s1c1
Sequence:CCGGCTTCTTATGGATTTGGATGTACTCGAGTACATCCAAATCCATAAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-517s1c1
Sequence:CCGGGATGTAGTAATGCGGAGTAGTCTCGAGACTACTCCGCATTACTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-185s1c1
Sequence:CCGGGTAAACGCAAAGCACTGAAGTCTCGAGACTTCAGTGCTTTGCGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003010.2-991s1c1
Sequence:CCGGCCAAAGTGGAATAGTGTATTTCTCGAGAAATACACTATTCCACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-904s1c1
Sequence:CCGGGCATCACGACAAGGATATGATCTCGAGATCATATCCTTGTCGTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003010.2-824s1c1
Sequence:CCGGGACAGCTTGTGGACTCTATTGCTCGAGCAATAGAGTCCACAAGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009157
MAP2K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-648s21c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-652s1c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-525s1c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-223s1c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-886s1c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-1128s21c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-1132s1c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-521s21c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-219s21c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-882s21c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009157
MAP2K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-648s21c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-652s1c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-525s1c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-223s1c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-886s1c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-1128s21c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-1132s1c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-521s21c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-219s21c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-882s21c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009157
MAP2K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-648s21c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-652s1c1
Sequence:CCGGCCGGAAGAGATCTTAGGCAAACTCGAGTTTGCCTAAGATCTCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-525s1c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-223s1c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-886s1c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-1128s21c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009157.2-1132s1c1
Sequence:CCGGCTTCTGAAACATCCCTTTATTCTCGAGAATAAAGGGATGTTTCAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-521s21c1
Sequence:CCGGCCCATACATTGTTCAGTTCTACTCGAGTAGAACTGAACAATGTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-219s21c1
Sequence:CCGGCGGTTTACTCTGAATCCTAATCTCGAGATTAGGATTCAGAGTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009157.4-882s21c1
Sequence:CCGGGCATCAAGACAAGGGTATGATCTCGAGATCATACCCTTGTCTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)