EMAIL THIS PAGE TO A FRIEND

MAP2K5

mitogen-activated protein kinase kinase 5

110 Gene Product Result for
Synonyms: HsT17454 MAPKK5 MEK5 PRKMK5
UniProtKB ID: Q13163, B4DE43, Q92961, Q92962
Gene ID:
Human(5607) Summary: The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
Mouse(23938) mitogen-activated protein kinase kinase 5
Rat(29568) mitogen activated protein kinase kinase 5
Zebrafish(100007679) mitogen-activated protein kinase kinase 5
domestic cat(101100725) mitogen-activated protein kinase kinase 5
cow(100295732) mitogen-activated protein kinase kinase 5
Horse(100052849) mitogen-activated protein kinase kinase 5
dog(609559) mitogen-activated protein kinase kinase 5
chicken(415557) mitogen-activated protein kinase kinase 5
sheep(101104069) mitogen-activated protein kinase kinase 5
Domestic Rabbit(100358715) mitogen-activated protein kinase kinase 5
naked mole-rat(101711080) mitogen-activated protein kinase kinase 5
domestic guinea pig(100732076) mitogen-activated protein kinase kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002757 siRNAs that have been validated in the lab human pricing
NM_145160 Rosetta Predictions human pricing
NM_001033987 Rosetta Predictions rat pricing
NM_017246 Rosetta Predictions rat pricing
NM_011840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002757 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115610 validated 846
1 SASI_Hs01_00115609 validated 1978
1 SASI_Hs01_00115611 validated 1452
2 SASI_Hs02_00334374 predicted 1358
3 SASI_Hs01_00115613 predicted 904
4 SASI_Hs01_00115614 predicted 812
5 SASI_Hs01_00115615 predicted 1237
6 SASI_Hs01_00115616 predicted 1055
7 SASI_Hs01_00115617 predicted 1147
8 SASI_Hs01_00115618 predicted 1131
9 SASI_Hs01_00115612 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096884 predicted 2004
2 SASI_Hs01_00096885 predicted 846
3 SASI_Hs02_00365010 predicted 1358
4 SASI_Hs01_00096886 predicted 1448
5 SASI_Hs01_00096888 predicted 905
6 SASI_Hs01_00096889 predicted 810
7 SASI_Hs01_00096890 predicted 1228
8 SASI_Hs01_00096891 predicted 1055
9 SASI_Hs01_00096892 predicted 1145
10 SASI_Hs01_00096893 predicted 1129
11 SASI_Hs01_00096887 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107101 predicted 1016
2 SASI_Rn01_00107102 predicted 869
3 SASI_Rn01_00107103 predicted 1005
4 SASI_Rn01_00107104 predicted 791
5 SASI_Rn01_00107105 predicted 1134
6 SASI_Rn01_00107106 predicted 1225
7 SASI_Rn02_00203867 predicted 1068
8 SASI_Rn01_00107109 predicted 796
9 SASI_Rn02_00203868 predicted 1166
10 SASI_Rn01_00107110 predicted 882
11 SASI_Rn01_00107107 predicted 846
12 SASI_Rn01_00107108 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099141 predicted 1012
2 SASI_Rn01_00099142 predicted 871
3 SASI_Rn01_00099143 predicted 1005
4 SASI_Rn01_00099144 predicted 794
5 SASI_Rn01_00099145 predicted 1139
6 SASI_Rn01_00099146 predicted 1222
7 SASI_Rn02_00261624 predicted 1070
8 SASI_Rn01_00099149 predicted 790
9 SASI_Rn02_00261625 predicted 1168
10 SASI_Rn01_00099150 predicted 889
11 SASI_Rn01_00099147 predicted 845
12 SASI_Rn01_00099148 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079314 predicted 863
2 SASI_Mm01_00079315 predicted 880
3 SASI_Mm01_00079316 predicted 997
4 SASI_Mm01_00079317 predicted 811
5 SASI_Mm01_00079318 predicted 837
6 SASI_Mm01_00079320 predicted 1128
7 SASI_Mm01_00079321 predicted 1568
8 SASI_Mm01_00079322 predicted 1163
9 SASI_Mm01_00079323 predicted 794
10 SASI_Mm02_00321570 predicted 1378
11 SASI_Mm01_00079319 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145162
VALIDATED
MAP2K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1154s1c1
Sequence:CCGGAGGACCAGTAACCAAGGAGAACTCGAGTTCTCCTTGGTTACTGGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-636s1c1
Sequence:CCGGGCCCTCCAATATGCTAGTAAACTCGAGTTTACTAGCATATTGGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145162.x-641s1c1
Sequence:CCGGCCAATATGCTAGTAAACACAACTCGAGTTGTGTTTACTAGCATATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-791s1c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1030s1c1
Sequence:CCGGCCGTTCATCGTGCAGTTCAATCTCGAGATTGAACTGCACGATGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145162
VALIDATED
MAP2K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1154s1c1
Sequence:CCGGAGGACCAGTAACCAAGGAGAACTCGAGTTCTCCTTGGTTACTGGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-636s1c1
Sequence:CCGGGCCCTCCAATATGCTAGTAAACTCGAGTTTACTAGCATATTGGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145162.x-641s1c1
Sequence:CCGGCCAATATGCTAGTAAACACAACTCGAGTTGTGTTTACTAGCATATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-791s1c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1030s1c1
Sequence:CCGGCCGTTCATCGTGCAGTTCAATCTCGAGATTGAACTGCACGATGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145162
VALIDATED
MAP2K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1154s1c1
Sequence:CCGGAGGACCAGTAACCAAGGAGAACTCGAGTTCTCCTTGGTTACTGGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-636s1c1
Sequence:CCGGGCCCTCCAATATGCTAGTAAACTCGAGTTTACTAGCATATTGGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145162.x-641s1c1
Sequence:CCGGCCAATATGCTAGTAAACACAACTCGAGTTGTGTTTACTAGCATATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-791s1c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_145162.x-1030s1c1
Sequence:CCGGCCGTTCATCGTGCAGTTCAATCTCGAGATTGAACTGCACGATGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011840
VALIDATED
MAP2K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011840.1-844s1c1
Sequence:CCGGCCTACTATTATTCCACAGTAACTCGAGTTACTGTGGAATAATAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1451s1c1
Sequence:CCGGGCCCTCCAACATGCTTGTAAACTCGAGTTTACAAGCATGTTGGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1853s1c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-644s1c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1405s1c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1404s21c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-643s21c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-833s21c1
Sequence:CCGGGCAATGCTGTCCTACTATTATCTCGAGATAATAGTAGGACAGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1852s21c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-890s21c1
Sequence:CCGGATAGAGCCGCTGCAGATATTTCTCGAGAAATATCTGCAGCGGCTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011840
VALIDATED
MAP2K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011840.1-844s1c1
Sequence:CCGGCCTACTATTATTCCACAGTAACTCGAGTTACTGTGGAATAATAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1451s1c1
Sequence:CCGGGCCCTCCAACATGCTTGTAAACTCGAGTTTACAAGCATGTTGGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1853s1c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-644s1c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1405s1c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1404s21c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-643s21c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-833s21c1
Sequence:CCGGGCAATGCTGTCCTACTATTATCTCGAGATAATAGTAGGACAGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1852s21c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-890s21c1
Sequence:CCGGATAGAGCCGCTGCAGATATTTCTCGAGAAATATCTGCAGCGGCTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011840
VALIDATED
MAP2K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011840.1-844s1c1
Sequence:CCGGCCTACTATTATTCCACAGTAACTCGAGTTACTGTGGAATAATAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1451s1c1
Sequence:CCGGGCCCTCCAACATGCTTGTAAACTCGAGTTTACAAGCATGTTGGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1853s1c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-644s1c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011840.1-1405s1c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1404s21c1
Sequence:CCGGGCCTTACCTATCTGTGGAGTTCTCGAGAACTCCACAGATAGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-643s21c1
Sequence:CCGGGCTGGTGATTCGGATCAAGATCTCGAGATCTTGATCCGAATCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-833s21c1
Sequence:CCGGGCAATGCTGTCCTACTATTATCTCGAGATAATAGTAGGACAGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-1852s21c1
Sequence:CCGGCGTGCAGTTCAATGATGGAAACTCGAGTTTCCATCATTGAACTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011840.2-890s21c1
Sequence:CCGGATAGAGCCGCTGCAGATATTTCTCGAGAAATATCTGCAGCGGCTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002757
VALIDATED
MAP2K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-690s1c1
Sequence:CCGGGAGAACCAGGTGCTGGTAATTCTCGAGAATTACCAGCACCTGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-1744s1c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-701s1c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-1230s1c1
Sequence:CCGGGCTGTAAAGGTCATACTACTACTCGAGTAGTAGTATGACCTTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-2025s1c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1452s21c1
Sequence:GTACCGGGTTGTTAAAGGCCTTACTTATCTCGAGATAAGTAAGGCCTTTAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1744s21c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1663s21c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002757.2-701s21c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-844s21c1
Sequence:CCGGATGAAGATGGTGATCGAATTACTCGAGTAATTCGATCACCATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002757.2-2025s21c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002757
VALIDATED
MAP2K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-690s1c1
Sequence:CCGGGAGAACCAGGTGCTGGTAATTCTCGAGAATTACCAGCACCTGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-1744s1c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-701s1c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-1230s1c1
Sequence:CCGGGCTGTAAAGGTCATACTACTACTCGAGTAGTAGTATGACCTTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-2025s1c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1452s21c1
Sequence:GTACCGGGTTGTTAAAGGCCTTACTTATCTCGAGATAAGTAAGGCCTTTAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1744s21c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1663s21c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002757.2-701s21c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-844s21c1
Sequence:CCGGATGAAGATGGTGATCGAATTACTCGAGTAATTCGATCACCATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002757.2-2025s21c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002757
VALIDATED
MAP2K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-690s1c1
Sequence:CCGGGAGAACCAGGTGCTGGTAATTCTCGAGAATTACCAGCACCTGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-1744s1c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-701s1c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002757.2-1230s1c1
Sequence:CCGGGCTGTAAAGGTCATACTACTACTCGAGTAGTAGTATGACCTTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002757.2-2025s1c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1452s21c1
Sequence:GTACCGGGTTGTTAAAGGCCTTACTTATCTCGAGATAAGTAAGGCCTTTAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1744s21c1
Sequence:CCGGGCATTGTTGATGAGGATTCGCCTCGAGGCGAATCCTCATCAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-1663s21c1
Sequence:CCGGCTGATGTCTGGAGCTTAGGAACTCGAGTTCCTAAGCTCCAGACATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002757.2-701s21c1
Sequence:CCGGGCTGGTAATTCGCATCAAGATCTCGAGATCTTGATGCGAATTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002757.2-844s21c1
Sequence:CCGGATGAAGATGGTGATCGAATTACTCGAGTAATTCGATCACCATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002757.2-2025s21c1
Sequence:CCGGCCGTCGCCCTTCTCCGTATGCCTCGAGGCATACGGAGAAGGGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)