EMAIL THIS PAGE TO A FRIEND

MAP2K6

mitogen-activated protein kinase kinase 6

118 Gene Product Result for
Synonyms: MAPKK6 MEK6 MKK6 PRKMK6 SAPKK-3 SAPKK3
UniProtKB ID: P52564
Gene ID:
Human(5608) Summary: This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
Mouse(26399) mitogen-activated protein kinase kinase 6
Rat(114495) mitogen-activated protein kinase kinase 6
domestic guinea pig(100731419) mitogen-activated protein kinase kinase 6
naked mole-rat(101703028) mitogen-activated protein kinase kinase 6
Domestic Rabbit(100355230) mitogen-activated protein kinase kinase 6
sheep(101115047) mitogen-activated protein kinase kinase 6
Zebrafish(65239) mitogen-activated protein kinase kinase 6
cow(286883) mitogen-activated protein kinase kinase 6
Horse(100053056) mitogen-activated protein kinase kinase 6
domestic cat(101089813) mitogen-activated protein kinase kinase 6
chicken(417445) mitogen-activated protein kinase kinase 6
dog(480454) mitogen-activated protein kinase kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M6446 Anti-MAP2K6 (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300422 Anti-MAP2K6 (Ab-207) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA031134 Anti-MAP2K6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502413 Anti-MAP2K6, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4502412 Anti-MKK6 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1302493 ANTI-MOUSE MAP2K6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300120 Anti-phospho-MAP2K6 (pSer207) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0005608M2 Monoclonal Anti-MAP2K6 antibody produced in mouse clone 2F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
SAB5300256 Monoclonal Anti-MAP2K6 antibody produced in mouse clone 3H12C8, ascites fluid mouse, human
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB5300257 Monoclonal Anti-MAP2K6 antibody produced in mouse clone 3H12B9, ascites fluid mouse, human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061101 MISSION® esiRNA esiRNA targeting mouse Map2k6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002758 Rosetta Predictions human pricing
NM_053703 Rosetta Predictions rat pricing
NM_011943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162806 predicted 1147
2 SASI_Hs01_00162807 predicted 1036
3 SASI_Hs01_00162808 predicted 1245
4 SASI_Hs01_00162810 predicted 839
5 SASI_Hs01_00162811 predicted 790
6 SASI_Hs01_00162812 predicted 1020
7 SASI_Hs02_00334375 predicted 703
8 SASI_Hs01_00162813 predicted 1154
9 SASI_Hs01_00162814 predicted 1233
10 SASI_Hs01_00162815 predicted 1120
11 SASI_Hs01_00162809 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049074 predicted 734
2 SASI_Rn01_00049075 predicted 195
3 SASI_Rn01_00049076 predicted 948
4 SASI_Rn01_00049077 predicted 1119
5 SASI_Rn01_00049078 predicted 1015
6 SASI_Rn01_00049079 predicted 767
7 SASI_Rn01_00049080 predicted 625
8 SASI_Rn01_00049082 predicted 1150
9 SASI_Rn01_00049083 predicted 911
10 SASI_Rn02_00266471 predicted 1024
11 SASI_Rn01_00049081 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127382 predicted 917
2 SASI_Mm01_00127384 predicted 377
3 SASI_Mm01_00127385 predicted 953
4 SASI_Mm01_00127386 predicted 773
5 SASI_Mm01_00127387 predicted 1197
6 SASI_Mm01_00127388 predicted 545
7 SASI_Mm01_00127389 predicted 1120
8 SASI_Mm01_00127390 predicted 738
9 SASI_Mm02_00321802 predicted 611
10 SASI_Mm01_00127391 predicted 1149
11 SASI_Mm01_00127383 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002758
VALIDATED
MAP2K6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-1033s21c1
Sequence:GTACCGGGAGTTGGCCATCCTTCGATTTCTCGAGAAATCGAAGGATGGCCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-439s21c1
Sequence:CCGGGATGACCTGGAGCCTATAATGCTCGAGCATTATAGGCTCCAGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002758.3-1455s21c1
Sequence:CCGGGGCCTTGGAATCTATAGTATACTCGAGTATACTATAGATTCCAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-576s21c1
Sequence:CCGGACTGATGGATTTGGATATTTCCTCGAGGAAATATCCAAATCCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-1207s21c1
Sequence:CCGGGAGCTAATGCAACATCCATTTCTCGAGAAATGGATGTTGCATTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-536s21c1
Sequence:GTACCGGGGATCCGAGCCACAGTAAATACTCGAGTATTTACTGTGGCTCGGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-849s21c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-1245s1c1
Sequence:CCGGGGCCTACATACCCAGAGCTAACTCGAGTTAGCTCTGGGTATGTAGGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-623s1c1
Sequence:CCGGCGGCTACTGATGGATTTGGATCTCGAGATCCAAATCCATCAGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-901s1c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-592s1c1
Sequence:CCGGCCGAGCCACAGTAAATAGCCACTCGAGTGGCTATTTACTGTGGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-503s1c1
Sequence:CCGGCCTATAATGGAACTGGGACGACTCGAGTCGTCCCAGTTCCATTATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002758.3-1625s1c1
Sequence:CCGGGCTACGGTAGTGATGAAATTACTCGAGTAATTTCATCACTACCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002758.3-1073s1c1
Sequence:CCGGCTCCATTTCAGCAGCTCAAACCTCGAGGTTTGAGCTGCTGAAATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002758
VALIDATED
MAP2K6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-1033s21c1
Sequence:GTACCGGGAGTTGGCCATCCTTCGATTTCTCGAGAAATCGAAGGATGGCCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-439s21c1
Sequence:CCGGGATGACCTGGAGCCTATAATGCTCGAGCATTATAGGCTCCAGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002758.3-1455s21c1
Sequence:CCGGGGCCTTGGAATCTATAGTATACTCGAGTATACTATAGATTCCAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-576s21c1
Sequence:CCGGACTGATGGATTTGGATATTTCCTCGAGGAAATATCCAAATCCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-1207s21c1
Sequence:CCGGGAGCTAATGCAACATCCATTTCTCGAGAAATGGATGTTGCATTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-536s21c1
Sequence:GTACCGGGGATCCGAGCCACAGTAAATACTCGAGTATTTACTGTGGCTCGGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-849s21c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-1245s1c1
Sequence:CCGGGGCCTACATACCCAGAGCTAACTCGAGTTAGCTCTGGGTATGTAGGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-623s1c1
Sequence:CCGGCGGCTACTGATGGATTTGGATCTCGAGATCCAAATCCATCAGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-901s1c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-592s1c1
Sequence:CCGGCCGAGCCACAGTAAATAGCCACTCGAGTGGCTATTTACTGTGGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-503s1c1
Sequence:CCGGCCTATAATGGAACTGGGACGACTCGAGTCGTCCCAGTTCCATTATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002758.3-1625s1c1
Sequence:CCGGGCTACGGTAGTGATGAAATTACTCGAGTAATTTCATCACTACCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002758.3-1073s1c1
Sequence:CCGGCTCCATTTCAGCAGCTCAAACCTCGAGGTTTGAGCTGCTGAAATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002758
VALIDATED
MAP2K6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-1033s21c1
Sequence:GTACCGGGAGTTGGCCATCCTTCGATTTCTCGAGAAATCGAAGGATGGCCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-439s21c1
Sequence:CCGGGATGACCTGGAGCCTATAATGCTCGAGCATTATAGGCTCCAGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002758.3-1455s21c1
Sequence:CCGGGGCCTTGGAATCTATAGTATACTCGAGTATACTATAGATTCCAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002758.3-576s21c1
Sequence:CCGGACTGATGGATTTGGATATTTCCTCGAGGAAATATCCAAATCCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-1207s21c1
Sequence:CCGGGAGCTAATGCAACATCCATTTCTCGAGAAATGGATGTTGCATTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-536s21c1
Sequence:GTACCGGGGATCCGAGCCACAGTAAATACTCGAGTATTTACTGTGGCTCGGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002758.3-849s21c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-1245s1c1
Sequence:CCGGGGCCTACATACCCAGAGCTAACTCGAGTTAGCTCTGGGTATGTAGGCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-623s1c1
Sequence:CCGGCGGCTACTGATGGATTTGGATCTCGAGATCCAAATCCATCAGTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002758.x-901s1c1
Sequence:CCGGCAATGCTCTCGGTCAAGTGAACTCGAGTTCACTTGACCGAGAGCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-592s1c1
Sequence:CCGGCCGAGCCACAGTAAATAGCCACTCGAGTGGCTATTTACTGTGGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002758.x-503s1c1
Sequence:CCGGCCTATAATGGAACTGGGACGACTCGAGTCGTCCCAGTTCCATTATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002758.3-1625s1c1
Sequence:CCGGGCTACGGTAGTGATGAAATTACTCGAGTAATTTCATCACTACCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002758.3-1073s1c1
Sequence:CCGGCTCCATTTCAGCAGCTCAAACCTCGAGGTTTGAGCTGCTGAAATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011943
VALIDATED
MAP2K6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-1139s21c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-544s21c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-1194s21c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-728s21c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-831s21c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1195s1c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1140s1c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-545s1c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-729s1c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-832s1c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011943
VALIDATED
MAP2K6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-1139s21c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-544s21c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-1194s21c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-728s21c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-831s21c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1195s1c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1140s1c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-545s1c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-729s1c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-832s1c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011943
VALIDATED
MAP2K6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-1139s21c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-544s21c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-1194s21c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011943.2-728s21c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011943.2-831s21c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1195s1c1
Sequence:CCGGGCCCACATATCCAGAGCTTATCTCGAGATAAGCTCTGGATATGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-1140s1c1
Sequence:CCGGCCGCGGACTTTGTTGACTTTACTCGAGTAAAGTCAACAAAGTCCGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-545s1c1
Sequence:CCGGGCCACAGTTAATAGCCAGGAACTCGAGTTCCTGGCTATTAACTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-729s1c1
Sequence:CCGGGCCAAACAATTCCAGAGGATACTCGAGTATCCTCTGGAATTGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011943.1-832s1c1
Sequence:CCGGGCCTTCTAATGTGCTCATTAACTCGAGTTAATGAGCACATTAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)