EMAIL THIS PAGE TO A FRIEND

MAP2K7

mitogen-activated protein kinase kinase 7

159 Gene Product Result for
Synonyms: Jnkk2 MAPKK7 MKK7 PRKMK7 SAPKK-4 SAPKK4
Gene ID:
Human(5609) Summary: The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell responses to proinflammatory cytokines, and environmental stresses. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found, but only one transcript variant has been supported and defined. [provided by RefSeq, Jul 2008]
Mouse(26400) mitogen-activated protein kinase kinase 7
Rat(363855) mitogen activated protein kinase kinase 7
Zebrafish(560913) mitogen-activated protein kinase kinase 7
dog(485004) mitogen-activated protein kinase kinase 7
cow(787278) mitogen-activated protein kinase kinase 7
domestic cat(101095157) mitogen-activated protein kinase kinase 7
sheep(100302082) mitogen-activated protein kinase kinase 7
naked mole-rat(101710666) mitogen-activated protein kinase kinase 7
domestic guinea pig(100731057) mitogen-activated protein kinase kinase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001633 Anti-MAP2K7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104449 Anti-MAP2K7 antibody produced in rabbit affinity isolated antibody zebrafish, sheep, rabbit, rat, mouse, human, guinea pig, horse
western blot pricing
SAB4502414 Anti-MAP2K7 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB1411096 Anti-MAP2K7 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA064711 Anti-MAP2K7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1302492 ANTI-MOUSE MAP2K7 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504623 Anti-phospho-MAP2K7 (pSer271) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301303 Anti-phospho-MAP2K7 (pSer271) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504624 Anti-phospho-MAP2K7 (pThr275) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301304 Anti-phospho-MAP2K7 (pThr275) antibody produced in rabbit affinity isolated antibody human
western blot pricing
M4818 Anti-phospho-MEK7 (pSer271/pThr275) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
WH0005609M1 Monoclonal Anti-MAP2K7 antibody produced in mouse clone 4E8, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1409528 Monoclonal Anti-MAP2K7 antibody produced in mouse clone 6A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409529 Monoclonal Anti-MAP2K7 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404255 Monoclonal Anti-MAP2K7, (N-terminal) antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P215 PD 98,059 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145185 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136181 MISSION® esiRNA esiRNA human MAP2K7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145185 Rosetta Predictions human pricing
NM_001025425 Rosetta Predictions rat pricing
NM_001042557 Rosetta Predictions mouse pricing
NM_011944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059905 predicted 1046
2 SASI_Hs01_00059906 predicted 1133
3 SASI_Hs01_00059907 predicted 710
4 SASI_Hs01_00059908 predicted 603
5 SASI_Hs02_00365038 predicted 1078
6 SASI_Hs01_00059909 predicted 826
7 SASI_Hs01_00059910 predicted 736
8 SASI_Hs02_00365039 predicted 1060
9 SASI_Hs01_00059911 predicted 537
10 SASI_Hs01_00059912 predicted 958
11 SASI_Hs01_00059904 predicted 500
12 SASI_Hs01_00059913 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106257 predicted 426
2 SASI_Rn01_00106258 predicted 262
3 SASI_Rn01_00106259 predicted 474
4 SASI_Rn01_00106260 predicted 765
5 SASI_Rn01_00106261 predicted 256
6 SASI_Rn01_00106262 predicted 327
7 SASI_Rn01_00106263 predicted 479
8 SASI_Rn01_00106264 predicted 756
9 SASI_Rn01_00106265 predicted 638
10 SASI_Rn02_00203173 predicted 233
11 SASI_Rn01_00106266 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290595 predicted 820
2 SASI_Mm02_00290596 predicted 736
3 SASI_Mm02_00290597 predicted 563
4 SASI_Mm02_00290598 predicted 418
5 SASI_Mm02_00290599 predicted 831
6 SASI_Mm02_00290600 predicted 738
7 SASI_Mm02_00290601 predicted 750
8 SASI_Mm02_00290602 predicted 579
9 SASI_Mm02_00290603 predicted 602
10 SASI_Mm02_00290604 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157998 predicted 817
2 SASI_Mm01_00157999 predicted 720
3 SASI_Mm01_00158000 predicted 548
4 SASI_Mm01_00158001 predicted 410
5 SASI_Mm01_00158002 predicted 812
6 SASI_Mm01_00158003 predicted 719
7 SASI_Mm01_00158004 predicted 731
8 SASI_Mm01_00158005 predicted 569
9 SASI_Mm02_00321803 predicted 597
10 SASI_Mm02_00321804 predicted 410
11 SASI_Mm01_00157996 predicted 434
12 SASI_Mm01_00157997 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005043
VALIDATED
MAP2K7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-723s1c1
Sequence:CCGGCCCTACATCGTGCAGTGCTTTCTCGAGAAAGCACTGCACGATGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-1157s1c1
Sequence:CCGGCTACAAGAACTGCAAGACGGACTCGAGTCCGTCTTGCAGTTCTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-1287s1c1
Sequence:CCGGCACAGGAAGAGACCAAAGTATCTCGAGATACTTTGGTCTCTTCCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-329s1c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005043.x-869s1c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005043
VALIDATED
MAP2K7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-723s1c1
Sequence:CCGGCCCTACATCGTGCAGTGCTTTCTCGAGAAAGCACTGCACGATGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-1157s1c1
Sequence:CCGGCTACAAGAACTGCAAGACGGACTCGAGTCCGTCTTGCAGTTCTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-1287s1c1
Sequence:CCGGCACAGGAAGAGACCAAAGTATCTCGAGATACTTTGGTCTCTTCCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-329s1c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005043.x-869s1c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005043
VALIDATED
MAP2K7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-723s1c1
Sequence:CCGGCCCTACATCGTGCAGTGCTTTCTCGAGAAAGCACTGCACGATGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005043.x-1157s1c1
Sequence:CCGGCTACAAGAACTGCAAGACGGACTCGAGTCCGTCTTGCAGTTCTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-1287s1c1
Sequence:CCGGCACAGGAAGAGACCAAAGTATCTCGAGATACTTTGGTCTCTTCCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005043.x-329s1c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005043.x-869s1c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011944
VALIDATED
MAP2K7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 7
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011944.1-1931s1c1
Sequence:CCGGGCACTTACTATGCACTGACATCTCGAGATGTCAGTGCATAGTAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-534s1c1
Sequence:CCGGCCTTACATCGTTCAGTGCTTTCTCGAGAAAGCACTGAACGATGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-335s1c1
Sequence:CCGGCCAGCGTTATCAGGCAGAAATCTCGAGATTTCTGCCTGATAACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-731s1c1
Sequence:CCGGCGATGTCAAACCCTCCAACATCTCGAGATGTTGGAGGGTTTGACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-1069s1c1
Sequence:CCGGCATTTGTCAAAGACTGCCTTACTCGAGTAAGGCAGTCTTTGACAAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1150s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-641s21c1
Sequence:CCGGTCACCAACACAGACGTCTTTACTCGAGTAAAGACGTCTGTGTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.2-1451s21c1
Sequence:CCGGCCAAGGACTGAGGACAGAAAGCTCGAGCTTTCTGTCCTCAGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-338s21c1
Sequence:CCGGGTATGGAGAGCATCGAGATTGCTCGAGCAATCTCGATGCTCTCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1246s21c1
Sequence:CCGGGATGTCGCGTCCTGGTTTAAGCTCGAGCTTAAACCAGGACGCGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.3-1708s21c1
Sequence:CCGGCATGAGCAGACTCGCTATTTACTCGAGTAAATAGCGAGTCTGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-1138s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-640s21c1
Sequence:CCGGAGGAAGAGAATAAGCGCATTTCTCGAGAAATGCGCTTATTCTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011944
VALIDATED
MAP2K7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 7
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011944.1-1931s1c1
Sequence:CCGGGCACTTACTATGCACTGACATCTCGAGATGTCAGTGCATAGTAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-534s1c1
Sequence:CCGGCCTTACATCGTTCAGTGCTTTCTCGAGAAAGCACTGAACGATGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-335s1c1
Sequence:CCGGCCAGCGTTATCAGGCAGAAATCTCGAGATTTCTGCCTGATAACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-731s1c1
Sequence:CCGGCGATGTCAAACCCTCCAACATCTCGAGATGTTGGAGGGTTTGACATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-1069s1c1
Sequence:CCGGCATTTGTCAAAGACTGCCTTACTCGAGTAAGGCAGTCTTTGACAAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1150s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-641s21c1
Sequence:CCGGTCACCAACACAGACGTCTTTACTCGAGTAAAGACGTCTGTGTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.2-1451s21c1
Sequence:CCGGCCAAGGACTGAGGACAGAAAGCTCGAGCTTTCTGTCCTCAGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-338s21c1
Sequence:CCGGGTATGGAGAGCATCGAGATTGCTCGAGCAATCTCGATGCTCTCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1246s21c1
Sequence:CCGGGATGTCGCGTCCTGGTTTAAGCTCGAGCTTAAACCAGGACGCGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.3-1708s21c1
Sequence:CCGGCATGAGCAGACTCGCTATTTACTCGAGTAAATAGCGAGTCTGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-1138s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-640s21c1
Sequence:CCGGAGGAAGAGAATAAGCGCATTTCTCGAGAAATGCGCTTATTCTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011944
VALIDATED
MAP2K7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 7
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011944.1-1931s1c1
Sequence:CCGGGCACTTACTATGCACTGACATCTCGAGATGTCAGTGCATAGTAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-534s1c1
Sequence:CCGGCCTTACATCGTTCAGTGCTTTCTCGAGAAAGCACTGAACGATGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-335s1c1
Sequence:CCGGCCAGCGTTATCAGGCAGAAATCTCGAGATTTCTGCCTGATAACGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011944.1-731s1c1
Sequence:CCGGCGATGTCAAACCCTCCAACATCTCGAGATGTTGGAGGGTTTGACATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011944.1-1069s1c1
Sequence:CCGGCATTTGTCAAAGACTGCCTTACTCGAGTAAGGCAGTCTTTGACAAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1150s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-641s21c1
Sequence:CCGGTCACCAACACAGACGTCTTTACTCGAGTAAAGACGTCTGTGTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.2-1451s21c1
Sequence:CCGGCCAAGGACTGAGGACAGAAAGCTCGAGCTTTCTGTCCTCAGTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-338s21c1
Sequence:CCGGGTATGGAGAGCATCGAGATTGCTCGAGCAATCTCGATGCTCTCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.2-1246s21c1
Sequence:CCGGGATGTCGCGTCCTGGTTTAAGCTCGAGCTTAAACCAGGACGCGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011944.3-1708s21c1
Sequence:CCGGCATGAGCAGACTCGCTATTTACTCGAGTAAATAGCGAGTCTGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-1138s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011944.3-640s21c1
Sequence:CCGGAGGAAGAGAATAAGCGCATTTCTCGAGAAATGCGCTTATTCTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145185
VALIDATED
MAP2K7 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145185.2-2622s1c1
Sequence:CCGGGCAAATCAAGTGGACAAGAAACTCGAGTTTCTTGTCCACTTGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145185.2-725s1c1
Sequence:CCGGCAAGATGACAGTGGCGATTGTCTCGAGACAATCGCCACTGTCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-497s21c1
Sequence:GTACCGGCGTCATTGCCGTTAAGCAAATCTCGAGATTTGCTTAACGGCAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1578s21c1
Sequence:CCGGGATCAGAGTCGCTGTTCATTCCTCGAGGAATGAACAGCGACTCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-329s21c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1134s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-740s21c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-1033s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1547s21c1
Sequence:GTACCGGCAGACACTGTGAACGGAAGACCTCGAGGTCTTCCGTTCACAGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145185
VALIDATED
MAP2K7 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145185.2-2622s1c1
Sequence:CCGGGCAAATCAAGTGGACAAGAAACTCGAGTTTCTTGTCCACTTGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145185.2-725s1c1
Sequence:CCGGCAAGATGACAGTGGCGATTGTCTCGAGACAATCGCCACTGTCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-497s21c1
Sequence:GTACCGGCGTCATTGCCGTTAAGCAAATCTCGAGATTTGCTTAACGGCAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1578s21c1
Sequence:CCGGGATCAGAGTCGCTGTTCATTCCTCGAGGAATGAACAGCGACTCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-329s21c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1134s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-740s21c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-1033s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1547s21c1
Sequence:GTACCGGCAGACACTGTGAACGGAAGACCTCGAGGTCTTCCGTTCACAGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145185
VALIDATED
MAP2K7 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145185.2-2622s1c1
Sequence:CCGGGCAAATCAAGTGGACAAGAAACTCGAGTTTCTTGTCCACTTGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145185.2-725s1c1
Sequence:CCGGCAAGATGACAGTGGCGATTGTCTCGAGACAATCGCCACTGTCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-497s21c1
Sequence:GTACCGGCGTCATTGCCGTTAAGCAAATCTCGAGATTTGCTTAACGGCAATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1578s21c1
Sequence:CCGGGATCAGAGTCGCTGTTCATTCCTCGAGGAATGAACAGCGACTCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-329s21c1
Sequence:CCGGGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1134s21c1
Sequence:CCGGGTCAAAGACTGCCTTACTAAACTCGAGTTTAGTAAGGCAGTCTTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-740s21c1
Sequence:CCGGGATTGTGAAGGCGCTGTACTACTCGAGTAGTACAGCGCCTTCACAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145185.2-1033s21c1
Sequence:CCGGAGAACTGCAAGACGGACTTTGCTCGAGCAAAGTCCGTCTTGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145185.2-1547s21c1
Sequence:GTACCGGCAGACACTGTGAACGGAAGACCTCGAGGTCTTCCGTTCACAGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)