EMAIL THIS PAGE TO A FRIEND

MAP3K10

mitogen-activated protein kinase kinase kinase 10

139 Gene Product Result for
Synonyms: MEKK10 MLK2 MST
UniProtKB ID: Q02779, Q12761, Q14871
Gene ID:
Human(4294) Summary: The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase has been shown to activate MAPK8/JNK and MKK4/SEK1, and this kinase itself can be phoshorylated, and thus activated by JNK kinases. This kinase functions preferentially on the JNK signaling pathway, and is reported to be involved in nerve growth factor (NGF) induced neuronal apoptosis. [provided by RefSeq, Jul 2008]
Mouse(269881) mitogen-activated protein kinase kinase kinase 10
Rat(308463) mitogen activated protein kinase kinase kinase 10
Zebrafish(560932) mitogen-activated protein kinase kinase kinase 10
domestic cat(101089731) mitogen-activated protein kinase kinase kinase 10
cow(781037) mitogen-activated protein kinase kinase kinase 10
Horse(100067981) mitogen-activated protein kinase kinase kinase 10
dog(484504) mitogen-activated protein kinase kinase kinase 10
Domestic Rabbit(100343621) mitogen-activated protein kinase kinase kinase 10
naked mole-rat(101718471) mitogen-activated protein kinase kinase kinase 10
domestic guinea pig(100716869) mitogen-activated protein kinase kinase kinase 10
sheep(101118723) mitogen-activated protein kinase kinase kinase 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_194344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_194344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_194344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002446 Rosetta Predictions human pricing
XM_001073032 Rosetta Predictions rat pricing
XM_218368 Rosetta Predictions rat pricing
NM_001081292 Rosetta Predictions mouse pricing
XM_194344 Rosetta Predictions mouse pricing
XM_887283 Rosetta Predictions mouse pricing
XM_897323 Rosetta Predictions mouse pricing
XM_922140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243471 predicted 1329
2 SASI_Hs01_00243472 predicted 1090
3 SASI_Hs01_00243473 predicted 1376
4 SASI_Hs01_00243474 predicted 782
5 SASI_Hs01_00243475 predicted 1108
6 SASI_Hs01_00243476 predicted 1718
7 SASI_Hs01_00243478 predicted 1326
8 SASI_Hs02_00333849 predicted 1425
9 SASI_Hs01_00243479 predicted 1569
10 SASI_Hs01_00243480 predicted 1982
11 SASI_Hs01_00243477 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341317 predicted 1056
2 SASI_Rn02_00341318 predicted 1367
3 SASI_Rn02_00341319 predicted 951
4 SASI_Rn02_00341320 predicted 3110
5 SASI_Rn02_00341321 predicted 2669
6 SASI_Rn02_00341322 predicted 677
7 SASI_Rn02_00341323 predicted 2829
8 SASI_Rn02_00341324 predicted 2155
9 SASI_Rn02_00341325 predicted 1490
10 SASI_Rn02_00341326 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377711 predicted 1058
2 SASI_Rn02_00377712 predicted 1370
3 SASI_Rn02_00377713 predicted 956
4 SASI_Rn02_00377714 predicted 684
5 SASI_Rn02_00377715 predicted 2144
6 SASI_Rn02_00377716 predicted 2149
7 SASI_Rn02_00377717 predicted 1492
8 SASI_Rn02_00377718 predicted 1520
9 SASI_Rn02_00377719 predicted 1520
10 SASI_Rn02_00377720 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297041 predicted 1185
2 SASI_Mm02_00297042 predicted 2105
3 SASI_Mm02_00297043 predicted 1287
4 SASI_Mm02_00297044 predicted 3318
5 SASI_Mm02_00297045 predicted 956
6 SASI_Mm02_00297046 predicted 1853
7 SASI_Mm02_00297047 predicted 2900
8 SASI_Mm02_00297048 predicted 2382
9 SASI_Mm02_00297049 predicted 1247
10 SASI_Mm02_00297050 predicted 2808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266692 predicted 2109
2 SASI_Mm01_00266693 predicted 3313
3 SASI_Mm01_00266694 predicted 968
4 SASI_Mm01_00266695 predicted 1863
5 SASI_Mm01_00266696 predicted 2907
6 SASI_Mm01_00266697 predicted 2389
7 SASI_Mm01_00266698 predicted 1721
8 SASI_Mm01_00266699 predicted 2814
9 SASI_Mm01_00266700 predicted 909
10 SASI_Mm01_00266701 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252081 predicted 2112
2 SASI_Mm01_00252082 predicted 3325
3 SASI_Mm01_00252083 predicted 965
4 SASI_Mm01_00252084 predicted 1855
5 SASI_Mm01_00252085 predicted 2905
6 SASI_Mm01_00252086 predicted 2391
7 SASI_Mm01_00252087 predicted 1723
8 SASI_Mm01_00252088 predicted 2813
9 SASI_Mm01_00252089 predicted 908
10 SASI_Mm01_00252090 predicted 2123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285652 predicted 1186
2 SASI_Mm01_00285653 predicted 1289
3 SASI_Mm01_00285654 predicted 920
4 SASI_Mm01_00285655 predicted 960
5 SASI_Mm01_00285656 predicted 1196
6 SASI_Mm01_00285657 predicted 900
7 SASI_Mm01_00285658 predicted 1337
8 SASI_Mm01_00285659 predicted 1297
9 SASI_Mm01_00285660 predicted 935
10 SASI_Mm01_00285661 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210422 predicted 1727
2 SASI_Mm01_00210423 predicted 1190
3 SASI_Mm01_00210424 predicted 1288
4 SASI_Mm01_00210425 predicted 918
5 SASI_Mm01_00210426 predicted 963
6 SASI_Mm01_00210427 predicted 1717
7 SASI_Mm01_00210428 predicted 902
8 SASI_Mm01_00210429 predicted 1661
9 SASI_Mm01_00210430 predicted 1657
10 SASI_Mm01_00210431 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002446
MAP3K10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 10
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-581s21c1
Sequence:GTACCGGTGCAGCTAGAGGAGATCATCGCTCGAGCGATGATCTCCTCTAGCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1716s21c1
Sequence:CCGGGCCCTCTGGCTTTGAGCATAACTCGAGTTATGCTCAAAGCCAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1223s21c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1354s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1223s1c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1329s1c1
Sequence:CCGGGCCAGATTTCGGTAGCATCTTCTCGAGAAGATGCTACCGAAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1433s21c1
Sequence:CCGGTGGAGATTCAGCACATGTTTGCTCGAGCAAACATGTGCTGAATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002446.2-3247s21c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-905s21c1
Sequence:CCGGGCATGAACTACCTACACAATGCTCGAGCATTGTGTAGGTAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-789s1c1
Sequence:CCGGCCCACACCTCTGCCTAGTGATCTCGAGATCACTAGGCAGAGGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-1749s21c1
Sequence:GTACCGGGGCCTCTCCAACTCTGGATAACTCGAGTTATCCAGAGTTGGAGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002446.x-3247s1c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-954s1c1
Sequence:CCGGCCTCAAGTCCATCAACATCCTCTCGAGAGGATGTTGATGGACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-2033s1c1
Sequence:CCGGGAAGCAAACAGTGGTCATCAACTCGAGTTGATGACCACTGTTTGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-907s1c1
Sequence:CCGGATGAACTACCTACACAATGATCTCGAGATCATTGTGTAGGTAGTTCATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-1420s1c1
Sequence:CCGGGAAGACTGGAAGCTGGAGATTCTCGAGAATCTCCAGCTTCCAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002446
MAP3K10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 10
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-581s21c1
Sequence:GTACCGGTGCAGCTAGAGGAGATCATCGCTCGAGCGATGATCTCCTCTAGCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1716s21c1
Sequence:CCGGGCCCTCTGGCTTTGAGCATAACTCGAGTTATGCTCAAAGCCAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1223s21c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1354s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1223s1c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1329s1c1
Sequence:CCGGGCCAGATTTCGGTAGCATCTTCTCGAGAAGATGCTACCGAAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1433s21c1
Sequence:CCGGTGGAGATTCAGCACATGTTTGCTCGAGCAAACATGTGCTGAATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002446.2-3247s21c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-905s21c1
Sequence:CCGGGCATGAACTACCTACACAATGCTCGAGCATTGTGTAGGTAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-789s1c1
Sequence:CCGGCCCACACCTCTGCCTAGTGATCTCGAGATCACTAGGCAGAGGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-1749s21c1
Sequence:GTACCGGGGCCTCTCCAACTCTGGATAACTCGAGTTATCCAGAGTTGGAGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002446.x-3247s1c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-954s1c1
Sequence:CCGGCCTCAAGTCCATCAACATCCTCTCGAGAGGATGTTGATGGACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-2033s1c1
Sequence:CCGGGAAGCAAACAGTGGTCATCAACTCGAGTTGATGACCACTGTTTGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-907s1c1
Sequence:CCGGATGAACTACCTACACAATGATCTCGAGATCATTGTGTAGGTAGTTCATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-1420s1c1
Sequence:CCGGGAAGACTGGAAGCTGGAGATTCTCGAGAATCTCCAGCTTCCAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002446
MAP3K10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 10
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-581s21c1
Sequence:GTACCGGTGCAGCTAGAGGAGATCATCGCTCGAGCGATGATCTCCTCTAGCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1716s21c1
Sequence:CCGGGCCCTCTGGCTTTGAGCATAACTCGAGTTATGCTCAAAGCCAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1223s21c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1354s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1223s1c1
Sequence:CCGGCGTATGGCGTGGCTATGAATACTCGAGTATTCATAGCCACGCCATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-1329s1c1
Sequence:CCGGGCCAGATTTCGGTAGCATCTTCTCGAGAAGATGCTACCGAAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-1433s21c1
Sequence:CCGGTGGAGATTCAGCACATGTTTGCTCGAGCAAACATGTGCTGAATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002446.2-3247s21c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.2-905s21c1
Sequence:CCGGGCATGAACTACCTACACAATGCTCGAGCATTGTGTAGGTAGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.2-789s1c1
Sequence:CCGGCCCACACCTCTGCCTAGTGATCTCGAGATCACTAGGCAGAGGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002446.3-1749s21c1
Sequence:GTACCGGGGCCTCTCCAACTCTGGATAACTCGAGTTATCCAGAGTTGGAGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002446.x-3247s1c1
Sequence:CCGGGCAGGATGTTCACTCTATTTACTCGAGTAAATAGAGTGAACATCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-954s1c1
Sequence:CCGGCCTCAAGTCCATCAACATCCTCTCGAGAGGATGTTGATGGACTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-2033s1c1
Sequence:CCGGGAAGCAAACAGTGGTCATCAACTCGAGTTGATGACCACTGTTTGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-907s1c1
Sequence:CCGGATGAACTACCTACACAATGATCTCGAGATCATTGTGTAGGTAGTTCATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002446.x-1420s1c1
Sequence:CCGGGAAGACTGGAAGCTGGAGATTCTCGAGAATCTCCAGCTTCCAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081292
MAP3K10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-1191s21c1
Sequence:CCGGGCATGAACTATCTACACAATGCTCGAGCATTGTGTAGATAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2787s21c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081292.1-3496s21c1
Sequence:CCGGGCAGGATACTCACTCTATTTACTCGAGTAAATAGAGTGAGTATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2380s21c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2813s21c1
Sequence:CCGGTGTAACTCTACGCGCTCATTGCTCGAGCAATGAGCGCGTAGAGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081292
MAP3K10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-1191s21c1
Sequence:CCGGGCATGAACTATCTACACAATGCTCGAGCATTGTGTAGATAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2787s21c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081292.1-3496s21c1
Sequence:CCGGGCAGGATACTCACTCTATTTACTCGAGTAAATAGAGTGAGTATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2380s21c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2813s21c1
Sequence:CCGGTGTAACTCTACGCGCTCATTGCTCGAGCAATGAGCGCGTAGAGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081292
MAP3K10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-1191s21c1
Sequence:CCGGGCATGAACTATCTACACAATGCTCGAGCATTGTGTAGATAGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2787s21c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081292.1-3496s21c1
Sequence:CCGGGCAGGATACTCACTCTATTTACTCGAGTAAATAGAGTGAGTATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2380s21c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081292.1-2813s21c1
Sequence:CCGGTGTAACTCTACGCGCTCATTGCTCGAGCAATGAGCGCGTAGAGTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_194344
VALIDATED
MAP3K10 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-2213s1c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194344.3-946s1c1
Sequence:CCGGGCTATGAACAAGCTGACGCTACTCGAGTAGCGTCAGCTTGTTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1428s1c1
Sequence:CCGGGCCCTCTGGATTTGAACATAACTCGAGTTATGTTCAAATCCAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1806s1c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-669s1c1
Sequence:CCGGCAAGTCCATCAACATCCTAATCTCGAGATTAGGATGTTGATGGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_194344
VALIDATED
MAP3K10 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-2213s1c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194344.3-946s1c1
Sequence:CCGGGCTATGAACAAGCTGACGCTACTCGAGTAGCGTCAGCTTGTTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1428s1c1
Sequence:CCGGGCCCTCTGGATTTGAACATAACTCGAGTTATGTTCAAATCCAGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1806s1c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-669s1c1
Sequence:CCGGCAAGTCCATCAACATCCTAATCTCGAGATTAGGATGTTGATGGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_194344
VALIDATED
MAP3K10 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-2213s1c1
Sequence:CCGGTGGTGTCATTATCCTCTGTATCTCGAGATACAGAGGATAATGACACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_194344.3-946s1c1
Sequence:CCGGGCTATGAACAAGCTGACGCTACTCGAGTAGCGTCAGCTTGTTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1428s1c1
Sequence:CCGGGCCCTCTGGATTTGAACATAACTCGAGTTATGTTCAAATCCAGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-1806s1c1
Sequence:CCGGCCTCAACGAGATGGAAGAATTCTCGAGAATTCTTCCATCTCGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_194344.3-669s1c1
Sequence:CCGGCAAGTCCATCAACATCCTAATCTCGAGATTAGGATGTTGATGGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)