EMAIL THIS PAGE TO A FRIEND

MAP3K11

mitogen-activated protein kinase kinase kinase 11

144 Gene Product Result for
Synonyms: MEKK11 MLK-3 MLK3 PTK1 SPRK
UniProtKB ID: Q16584, Q53H00, Q59F06, Q6P2G4
Gene ID:
Human(4296) Summary: The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
Mouse(26403) mitogen-activated protein kinase kinase kinase 11
Rat(309168) mitogen-activated protein kinase kinase kinase 11
sheep(101108969) mitogen-activated protein kinase kinase kinase 11
domestic guinea pig(100730722) mitogen-activated protein kinase kinase kinase 11
naked mole-rat(101718575) mitogen-activated protein kinase kinase kinase 11
Domestic Rabbit(100356691) mitogen-activated protein kinase kinase kinase 11
cow(514210) mitogen-activated protein kinase kinase kinase 11
dog(483732) mitogen-activated protein kinase kinase kinase 11
domestic cat(101098654) mitogen-activated protein kinase kinase kinase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073871 MISSION® esiRNA esiRNA targeting mouse Map3k11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002419 Rosetta Predictions human pricing
NM_001013150 Rosetta Predictions rat pricing
XM_001070785 Rosetta Predictions rat pricing
NM_022012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333811 predicted 2814
2 SASI_Hs01_00195766 predicted 1272
3 SASI_Hs01_00195767 predicted 1249
4 SASI_Hs01_00195769 predicted 868
5 SASI_Hs02_00333812 predicted 2250
6 SASI_Hs01_00195770 predicted 2569
7 SASI_Hs01_00195771 predicted 1477
8 SASI_Hs01_00195772 predicted 1843
9 SASI_Hs01_00195773 predicted 1963
10 SASI_Hs01_00195774 predicted 1397
11 SASI_Hs01_00195768 predicted 2255
12 SASI_Hs01_00195775 predicted 2901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084895 predicted 1431
2 SASI_Rn01_00084896 predicted 2038
3 SASI_Rn01_00084897 predicted 894
4 SASI_Rn01_00084898 predicted 2325
5 SASI_Rn01_00084899 predicted 2261
6 SASI_Rn01_00084900 predicted 1217
7 SASI_Rn01_00084901 predicted 1436
8 SASI_Rn01_00084902 predicted 1310
9 SASI_Rn01_00084903 predicted 2204
10 SASI_Rn02_00200878 predicted 2764
11 SASI_Rn01_00084904 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332785 predicted 996
2 SASI_Rn02_00332786 predicted 1554
3 SASI_Rn02_00332787 predicted 2153
4 SASI_Rn02_00332788 predicted 1324
5 SASI_Rn02_00332789 predicted 1015
6 SASI_Rn02_00332790 predicted 2441
7 SASI_Rn02_00332791 predicted 2378
8 SASI_Rn02_00332792 predicted 1333
9 SASI_Rn02_00332793 predicted 1430
10 SASI_Rn02_00332794 predicted 2323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181565 predicted 3147
2 SASI_Mm01_00181566 predicted 1516
3 SASI_Mm01_00181567 predicted 2647
4 SASI_Mm01_00181569 predicted 1503
5 SASI_Mm02_00326484 predicted 1508
6 SASI_Mm01_00181571 predicted 2619
7 SASI_Mm01_00181572 predicted 1312
8 SASI_Mm01_00181573 predicted 2560
9 SASI_Mm01_00181574 predicted 3061
10 SASI_Mm02_00326485 predicted 1733
11 SASI_Mm01_00181568 predicted 853
12 SASI_Mm01_00181570 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022012
VALIDATED
MAP3K11 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2218s21c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1736s21c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2631s21c1
Sequence:CCGGATAGCTCTGGGACGCCTAAACCTCGAGGTTTAGGCGTCCCAGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-3316s21c1
Sequence:CCGGCTTCGAGGAGGCATAGCATACCTCGAGGTATGCTATGCCTCCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1253s21c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-2131s1c1
Sequence:CCGGCGTCTTGAAGATTCAAGCAATCTCGAGATTGCTTGAATCTTCAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1965s1c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022012.2-625s1c1
Sequence:CCGGCTGTTCGACTATGAGCCCAATCTCGAGATTGGGCTCATAGTCGAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1483s1c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1000s1c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022012
VALIDATED
MAP3K11 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2218s21c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1736s21c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2631s21c1
Sequence:CCGGATAGCTCTGGGACGCCTAAACCTCGAGGTTTAGGCGTCCCAGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-3316s21c1
Sequence:CCGGCTTCGAGGAGGCATAGCATACCTCGAGGTATGCTATGCCTCCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1253s21c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-2131s1c1
Sequence:CCGGCGTCTTGAAGATTCAAGCAATCTCGAGATTGCTTGAATCTTCAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1965s1c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022012.2-625s1c1
Sequence:CCGGCTGTTCGACTATGAGCCCAATCTCGAGATTGGGCTCATAGTCGAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1483s1c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1000s1c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022012
VALIDATED
MAP3K11 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2218s21c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1736s21c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-2631s21c1
Sequence:CCGGATAGCTCTGGGACGCCTAAACCTCGAGGTTTAGGCGTCCCAGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-3316s21c1
Sequence:CCGGCTTCGAGGAGGCATAGCATACCTCGAGGTATGCTATGCCTCCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022012.3-1253s21c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-2131s1c1
Sequence:CCGGCGTCTTGAAGATTCAAGCAATCTCGAGATTGCTTGAATCTTCAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1965s1c1
Sequence:CCGGCCTGGATTTCAAACACCGCATCTCGAGATGCGGTGTTTGAAATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022012.2-625s1c1
Sequence:CCGGCTGTTCGACTATGAGCCCAATCTCGAGATTGGGCTCATAGTCGAACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1483s1c1
Sequence:CCGGGCTGTAAACAAGTTAACGTTACTCGAGTAACGTTAACTTGTTTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022012.2-1000s1c1
Sequence:CCGGCCCAACATCATTGCCCTCAAACTCGAGTTTGAGGGCAATGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002419
VALIDATED
MAP3K11 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 11
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3071s21c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1269s21c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-1966s1c1
Sequence:CCGGTATCAGCATGCCACTCGACTTCTCGAGAAGTCGAGTGGCATGCTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002419.3-596s1c1
Sequence:CCGGTCTCCAAAGGCAGCGGGTTATCTCGAGATAACCCGCTGCCTTTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3244s21c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1250s21c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021568    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-1250s1c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002419.2-1501s1c1
Sequence:CCGGTAACAAGCTCACACTGCCCATCTCGAGATGGGCAGTGTGAGCTTGTTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021566    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-774s1c1
Sequence:CCGGTCTTCCCGTCCAACTATGTGTCTCGAGACACATAGTTGGACGGGAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021564    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-3071s1c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021567    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002419.2-1269s1c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3244s1c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3421s1c1
Sequence:CCGGCCTAGGGCTTAGAGCATGGACCTCGAGGTCCATGCTCTAAGCCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002419
VALIDATED
MAP3K11 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 11
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3071s21c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1269s21c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-1966s1c1
Sequence:CCGGTATCAGCATGCCACTCGACTTCTCGAGAAGTCGAGTGGCATGCTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002419.3-596s1c1
Sequence:CCGGTCTCCAAAGGCAGCGGGTTATCTCGAGATAACCCGCTGCCTTTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3244s21c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1250s21c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021568    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-1250s1c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002419.2-1501s1c1
Sequence:CCGGTAACAAGCTCACACTGCCCATCTCGAGATGGGCAGTGTGAGCTTGTTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021566    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-774s1c1
Sequence:CCGGTCTTCCCGTCCAACTATGTGTCTCGAGACACATAGTTGGACGGGAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021564    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-3071s1c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021567    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002419.2-1269s1c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3244s1c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3421s1c1
Sequence:CCGGCCTAGGGCTTAGAGCATGGACCTCGAGGTCCATGCTCTAAGCCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002419
VALIDATED
MAP3K11 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 11
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342540    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3071s21c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1269s21c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-1966s1c1
Sequence:CCGGTATCAGCATGCCACTCGACTTCTCGAGAAGTCGAGTGGCATGCTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002419.3-596s1c1
Sequence:CCGGTCTCCAAAGGCAGCGGGTTATCTCGAGATAACCCGCTGCCTTTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002419.3-3244s21c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002419.3-1250s21c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021568    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-1250s1c1
Sequence:CCGGATTGAGAGTGACGACATGGAGCTCGAGCTCCATGTCGTCACTCTCAATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002419.2-1501s1c1
Sequence:CCGGTAACAAGCTCACACTGCCCATCTCGAGATGGGCAGTGTGAGCTTGTTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021566    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-774s1c1
Sequence:CCGGTCTTCCCGTCCAACTATGTGTCTCGAGACACATAGTTGGACGGGAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021564    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002419.2-3071s1c1
Sequence:CCGGCTTAGGAGGAGTCACAGCATACTCGAGTATGCTGTGACTCCTCCTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021567    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002419.2-1269s1c1
Sequence:CCGGAGCACAAGACCCTGAAGATCACTCGAGTGATCTTCAGGGTCTTGTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3244s1c1
Sequence:CCGGCCAGCTCACCTGCCCTACTGGCTCGAGCCAGTAGGGCAGGTGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002419.3-3421s1c1
Sequence:CCGGCCTAGGGCTTAGAGCATGGACCTCGAGGTCCATGCTCTAAGCCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)