EMAIL THIS PAGE TO A FRIEND

MAP3K12

mitogen-activated protein kinase kinase kinase 12

151 Gene Product Result for
Synonyms: DLK MEKK12 MUK ZPK ZPKP1
UniProtKB ID: Q12852, B3KSS9, G3V1Y2, Q86VQ5, Q8WY25
Gene ID:
Human(7786) Summary: This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
Mouse(26404) mitogen-activated protein kinase kinase kinase 12
Rat(25579) mitogen activated protein kinase kinase kinase 12
Zebrafish(404626) mitogen-activated protein kinase kinase kinase 12
chicken(101669120) mitogen-activated protein kinase kinase kinase 12
cow(505427) mitogen-activated protein kinase kinase kinase 12
Horse(100064002) mitogen-activated protein kinase kinase kinase 12
domestic cat(101087164) mitogen-activated protein kinase kinase kinase 12
dog(607170) mitogen-activated protein kinase kinase kinase 12
chicken(101750914) mitogen-activated protein kinase kinase kinase 12
Domestic Rabbit(100358158) mitogen-activated protein kinase kinase kinase 12
naked mole-rat(101702332) mitogen-activated protein kinase kinase kinase 12
domestic guinea pig(100731317) mitogen-activated protein kinase kinase kinase 12
sheep(101102889) mitogen-activated protein kinase kinase kinase 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306766 ANTI-MAP3K12 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306765 ANTI-MAP3K12 antibody produced in mouse crude ascites, buffered aqueous solution mouse, human
western blot pricing
SAB2700169 Anti-Map3k12 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB2702473 Anti-Map3k12 antibody produced in rabbit affinity isolated antibody zebrafish
immunohistochemistry pricing
HPA039936 Anti-MAP3K12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA071996 Anti-MAP3K12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1302491 ANTI-MOUSE MAP3K12 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1300014 Anti-ZPK (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1300426 Anti-ZPK (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB1307114 ANTI-ZPK(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006301 Rosetta Predictions human pricing
NM_013055 Rosetta Predictions rat pricing
NM_009582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126354 predicted 576
2 SASI_Hs01_00126355 predicted 809
3 SASI_Hs01_00126356 predicted 387
4 SASI_Hs01_00126357 predicted 1399
5 SASI_Hs01_00126359 predicted 938
6 SASI_Hs01_00126360 predicted 863
7 SASI_Hs01_00126362 predicted 796
8 SASI_Hs01_00126363 predicted 894
9 SASI_Hs02_00341315 predicted 2429
10 SASI_Hs02_00341316 predicted 976
11 SASI_Hs01_00126358 predicted 2450
12 SASI_Hs01_00126361 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114868 predicted 3118
2 SASI_Rn01_00114869 predicted 750
3 SASI_Rn01_00114870 predicted 1855
4 SASI_Rn01_00114871 predicted 1836
5 SASI_Rn02_00260793 predicted 2879
6 SASI_Rn01_00114872 predicted 2910
7 SASI_Rn01_00114873 predicted 1306
8 SASI_Rn01_00114875 predicted 580
9 SASI_Rn01_00114876 predicted 1309
10 SASI_Rn01_00114877 predicted 3205
11 SASI_Rn01_00114874 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316484 predicted 1216
2 SASI_Mm01_00038412 predicted 2727
3 SASI_Mm01_00038413 predicted 354
4 SASI_Mm01_00038414 predicted 448
5 SASI_Mm01_00038415 predicted 1227
6 SASI_Mm01_00038417 predicted 280
7 SASI_Mm01_00038418 predicted 950
8 SASI_Mm01_00038420 predicted 1962
9 SASI_Mm02_00316485 predicted 883
10 SASI_Mm01_00038421 predicted 606
11 SASI_Mm01_00038416 predicted 2501
12 SASI_Mm01_00038419 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006301
VALIDATED
MAP3K12 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 12
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-933s1c1
Sequence:CCGGCCTGAGGTGATCCGCAATGAACTCGAGTTCATTGCGGATCACCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-2614s1c1
Sequence:CCGGGCACTGAATTGGACAACTCCACTCGAGTGGAGTTGTCCAATTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006301.x-2752s1c1
Sequence:CCGGGCGCCACATAATCAACAGAAACTCGAGTTTCTGTTGATTATGTGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-1373s1c1
Sequence:CCGGCAGGGAGCACTATGAAAGGAACTCGAGTTCCTTTCATAGTGCTCCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-566s1c1
Sequence:CCGGCCTCAAAGAAACCGACATCAACTCGAGTTGATGTCGGTTTCTTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-572s1c1
Sequence:CCGGAGAAACCGACATCAAGCACTTCTCGAGAAGTGCTTGATGTCGGTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-775s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-579s21c1
Sequence:CCGGGACATCAAGCACTTGCGAAAGCTCGAGCTTTCGCAAGTGCTTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2326s21c1
Sequence:CCGGACATGCGCCAGTCACTATCTACTCGAGTAGATAGTGACTGGCGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1471s21c1
Sequence:CCGGTCAGGCGAGAGCAAGCTTTAGCTCGAGCTAAAGCTTGCTCTCGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-842s21c1
Sequence:CCGGTGTGGTGAAGATCTCAGATTTCTCGAGAAATCTGAGATCTTCACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006301.2-2684s21c1
Sequence:CCGGACTCGTATTCCTTGTACATAGCTCGAGCTATGTACAAGGAATACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2672s21c1
Sequence:CCGGTCCATGAAAGCCACTCGTATTCTCGAGAATACGAGTGGCTTTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1620s21c1
Sequence:CCGGATCCTCAAGACGGAGTCTTTGCTCGAGCAAAGACTCCGTCTTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1149s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1138s21c1
Sequence:CCGGGGAATAGCAAACCACGAAATCCTCGAGGATTTCGTGGTTTGCTATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1409s21c1
Sequence:CCGGCAACCTGTATATGGAACTTAACTCGAGTTAAGTTCCATATACAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-809s21c1
Sequence:CCGGCAAGTCACCCAACATGCTAATCTCGAGATTAGCATGTTGGGTGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1366s21c1
Sequence:CCGGTGGACATCAGGGAGCACTATGCTCGAGCATAGTGCTCCCTGATGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006301
VALIDATED
MAP3K12 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 12
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-933s1c1
Sequence:CCGGCCTGAGGTGATCCGCAATGAACTCGAGTTCATTGCGGATCACCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-2614s1c1
Sequence:CCGGGCACTGAATTGGACAACTCCACTCGAGTGGAGTTGTCCAATTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006301.x-2752s1c1
Sequence:CCGGGCGCCACATAATCAACAGAAACTCGAGTTTCTGTTGATTATGTGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-1373s1c1
Sequence:CCGGCAGGGAGCACTATGAAAGGAACTCGAGTTCCTTTCATAGTGCTCCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-566s1c1
Sequence:CCGGCCTCAAAGAAACCGACATCAACTCGAGTTGATGTCGGTTTCTTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-572s1c1
Sequence:CCGGAGAAACCGACATCAAGCACTTCTCGAGAAGTGCTTGATGTCGGTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-775s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-579s21c1
Sequence:CCGGGACATCAAGCACTTGCGAAAGCTCGAGCTTTCGCAAGTGCTTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2326s21c1
Sequence:CCGGACATGCGCCAGTCACTATCTACTCGAGTAGATAGTGACTGGCGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1471s21c1
Sequence:CCGGTCAGGCGAGAGCAAGCTTTAGCTCGAGCTAAAGCTTGCTCTCGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-842s21c1
Sequence:CCGGTGTGGTGAAGATCTCAGATTTCTCGAGAAATCTGAGATCTTCACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006301.2-2684s21c1
Sequence:CCGGACTCGTATTCCTTGTACATAGCTCGAGCTATGTACAAGGAATACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2672s21c1
Sequence:CCGGTCCATGAAAGCCACTCGTATTCTCGAGAATACGAGTGGCTTTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1620s21c1
Sequence:CCGGATCCTCAAGACGGAGTCTTTGCTCGAGCAAAGACTCCGTCTTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1149s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1138s21c1
Sequence:CCGGGGAATAGCAAACCACGAAATCCTCGAGGATTTCGTGGTTTGCTATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1409s21c1
Sequence:CCGGCAACCTGTATATGGAACTTAACTCGAGTTAAGTTCCATATACAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-809s21c1
Sequence:CCGGCAAGTCACCCAACATGCTAATCTCGAGATTAGCATGTTGGGTGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1366s21c1
Sequence:CCGGTGGACATCAGGGAGCACTATGCTCGAGCATAGTGCTCCCTGATGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006301
VALIDATED
MAP3K12 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 12
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-933s1c1
Sequence:CCGGCCTGAGGTGATCCGCAATGAACTCGAGTTCATTGCGGATCACCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006301.2-2614s1c1
Sequence:CCGGGCACTGAATTGGACAACTCCACTCGAGTGGAGTTGTCCAATTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006301.x-2752s1c1
Sequence:CCGGGCGCCACATAATCAACAGAAACTCGAGTTTCTGTTGATTATGTGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-1373s1c1
Sequence:CCGGCAGGGAGCACTATGAAAGGAACTCGAGTTCCTTTCATAGTGCTCCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-566s1c1
Sequence:CCGGCCTCAAAGAAACCGACATCAACTCGAGTTGATGTCGGTTTCTTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006301.x-572s1c1
Sequence:CCGGAGAAACCGACATCAAGCACTTCTCGAGAAGTGCTTGATGTCGGTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-775s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-579s21c1
Sequence:CCGGGACATCAAGCACTTGCGAAAGCTCGAGCTTTCGCAAGTGCTTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2326s21c1
Sequence:CCGGACATGCGCCAGTCACTATCTACTCGAGTAGATAGTGACTGGCGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1471s21c1
Sequence:CCGGTCAGGCGAGAGCAAGCTTTAGCTCGAGCTAAAGCTTGCTCTCGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-842s21c1
Sequence:CCGGTGTGGTGAAGATCTCAGATTTCTCGAGAAATCTGAGATCTTCACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006301.2-2684s21c1
Sequence:CCGGACTCGTATTCCTTGTACATAGCTCGAGCTATGTACAAGGAATACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-2672s21c1
Sequence:CCGGTCCATGAAAGCCACTCGTATTCTCGAGAATACGAGTGGCTTTCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1620s21c1
Sequence:CCGGATCCTCAAGACGGAGTCTTTGCTCGAGCAAAGACTCCGTCTTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1149s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1138s21c1
Sequence:CCGGGGAATAGCAAACCACGAAATCCTCGAGGATTTCGTGGTTTGCTATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1409s21c1
Sequence:CCGGCAACCTGTATATGGAACTTAACTCGAGTTAAGTTCCATATACAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-809s21c1
Sequence:CCGGCAAGTCACCCAACATGCTAATCTCGAGATTAGCATGTTGGGTGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006301.2-1366s21c1
Sequence:CCGGTGGACATCAGGGAGCACTATGCTCGAGCATAGTGCTCCCTGATGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009582
MAP3K12 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 12
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-607s1c1
Sequence:CCGGGCTGTGAAGAAGGTTCGAGATCTCGAGATCTCGAACCTTCTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1221s1c1
Sequence:CCGGCCCATCATTCCGACAGATCTTCTCGAGAAGATCTGTCGGAATGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-116s1c1
Sequence:CCGGCTACTCTAAGTGAGGCTTCTACTCGAGTAGAAGCCTCACTTAGAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1705s1c1
Sequence:CCGGCCTAAACTAGATGCAGCCCTACTCGAGTAGGGCTGCATCTAGTTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1690s21c1
Sequence:CCGGCAGAGTCGTTGCTACCTAAACCTCGAGGTTTAGGTAGCAACGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-104s21c1
Sequence:CCGGGGGCTTTGTGTCTACTCTAAGCTCGAGCTTAGAGTAGACACAAAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1209s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1072s21c1
Sequence:CCGGCTGGAGAGATTCCCTACAAAGCTCGAGCTTTGTAGGGAATCTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-2912s21c1
Sequence:CCGGTCCATGAAAGACACTCTTATTCTCGAGAATAAGAGTGTCTTTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1027s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1389s21c1
Sequence:CCGGTGGAACAGCAAACCACGAAATCTCGAGATTTCGTGGTTTGCTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009582
MAP3K12 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 12
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-607s1c1
Sequence:CCGGGCTGTGAAGAAGGTTCGAGATCTCGAGATCTCGAACCTTCTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1221s1c1
Sequence:CCGGCCCATCATTCCGACAGATCTTCTCGAGAAGATCTGTCGGAATGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-116s1c1
Sequence:CCGGCTACTCTAAGTGAGGCTTCTACTCGAGTAGAAGCCTCACTTAGAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1705s1c1
Sequence:CCGGCCTAAACTAGATGCAGCCCTACTCGAGTAGGGCTGCATCTAGTTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1690s21c1
Sequence:CCGGCAGAGTCGTTGCTACCTAAACCTCGAGGTTTAGGTAGCAACGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-104s21c1
Sequence:CCGGGGGCTTTGTGTCTACTCTAAGCTCGAGCTTAGAGTAGACACAAAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1209s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1072s21c1
Sequence:CCGGCTGGAGAGATTCCCTACAAAGCTCGAGCTTTGTAGGGAATCTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-2912s21c1
Sequence:CCGGTCCATGAAAGACACTCTTATTCTCGAGAATAAGAGTGTCTTTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1027s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1389s21c1
Sequence:CCGGTGGAACAGCAAACCACGAAATCTCGAGATTTCGTGGTTTGCTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009582
MAP3K12 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 12
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-607s1c1
Sequence:CCGGGCTGTGAAGAAGGTTCGAGATCTCGAGATCTCGAACCTTCTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1221s1c1
Sequence:CCGGCCCATCATTCCGACAGATCTTCTCGAGAAGATCTGTCGGAATGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-116s1c1
Sequence:CCGGCTACTCTAAGTGAGGCTTCTACTCGAGTAGAAGCCTCACTTAGAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009582.2-1705s1c1
Sequence:CCGGCCTAAACTAGATGCAGCCCTACTCGAGTAGGGCTGCATCTAGTTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1690s21c1
Sequence:CCGGCAGAGTCGTTGCTACCTAAACCTCGAGGTTTAGGTAGCAACGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-104s21c1
Sequence:CCGGGGGCTTTGTGTCTACTCTAAGCTCGAGCTTAGAGTAGACACAAAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1209s21c1
Sequence:CCGGCCACGAAATCGCCCATCATTCCTCGAGGAATGATGGGCGATTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.3-1072s21c1
Sequence:CCGGCTGGAGAGATTCCCTACAAAGCTCGAGCTTTGTAGGGAATCTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-2912s21c1
Sequence:CCGGTCCATGAAAGACACTCTTATTCTCGAGAATAAGAGTGTCTTTCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1027s21c1
Sequence:CCGGACCTGCACCTGCACAAGATTACTCGAGTAATCTTGTGCAGGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009582.4-1389s21c1
Sequence:CCGGTGGAACAGCAAACCACGAAATCTCGAGATTTCGTGGTTTGCTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)