EMAIL THIS PAGE TO A FRIEND

MAP3K13

mitogen-activated protein kinase kinase kinase 13

105 Gene Product Result for
Synonyms: LZK MEKK13 MLK
Gene ID:
Human(9175) Summary: The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(71751) mitogen-activated protein kinase kinase kinase 13
Rat(303823) mitogen-activated protein kinase kinase kinase 13
sheep(101117036) mitogen-activated protein kinase kinase kinase 13
domestic guinea pig(100727150) mitogen-activated protein kinase kinase kinase 13
naked mole-rat(101700680) mitogen-activated protein kinase kinase kinase 13
Domestic Rabbit(100345602) mitogen-activated protein kinase kinase kinase 13
chicken(424876) mitogen-activated protein kinase kinase kinase 13
cow(505369) mitogen-activated protein kinase kinase kinase 13
Horse(100059237) mitogen-activated protein kinase kinase kinase 13
domestic cat(101093205) mitogen-activated protein kinase kinase kinase 13
dog(100685499) mitogen-activated protein kinase kinase kinase 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300968 Anti-LZK (C-term) (S869) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300435 Anti-LZK (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB4503575 Anti-M3K13 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
M7196 Anti-MAP3K13 (506-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M7321 Anti-MAP3K13 (953-966) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306767 ANTI-MAP3K13 (LZK)(N-TERMINAL) antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1406788 Anti-MAP3K13 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA036691 Anti-MAP3K13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA036692 Anti-MAP3K13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA016497 Anti-MAP3K13 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402455 Monoclonal Anti-MAP3K13 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_484537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004721 Rosetta Predictions human pricing
NM_001013978 Rosetta Predictions rat pricing
XM_221319 Rosetta Predictions rat pricing
NM_172821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128618 predicted 2141
2 SASI_Hs01_00128619 predicted 2229
3 SASI_Hs01_00128620 predicted 2062
4 SASI_Hs01_00128621 predicted 663
5 SASI_Hs01_00128622 predicted 903
6 SASI_Hs01_00128624 predicted 1440
7 SASI_Hs02_00338194 predicted 1625
8 SASI_Hs01_00128625 predicted 877
9 SASI_Hs02_00338195 predicted 842
10 SASI_Hs01_00128626 predicted 1602
11 SASI_Hs01_00128623 predicted 2954
12 SASI_Hs01_00128627 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201320 predicted 1202
2 SASI_Rn02_00201321 predicted 1101
3 SASI_Rn02_00201322 predicted 1189
4 SASI_Rn02_00201323 predicted 2291
5 SASI_Rn02_00201324 predicted 1636
6 SASI_Rn02_00201325 predicted 1234
7 SASI_Rn02_00201326 predicted 2094
8 SASI_Rn02_00201327 predicted 3035
9 SASI_Rn02_00201328 predicted 2479
10 SASI_Rn02_00201329 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146696 predicted 1801
2 SASI_Rn01_00146697 predicted 1532
3 SASI_Rn01_00146698 predicted 1821
4 SASI_Rn01_00146699 predicted 1440
5 SASI_Rn01_00146700 predicted 1626
6 SASI_Rn01_00146701 predicted 1628
7 SASI_Rn01_00146702 predicted 1529
8 SASI_Rn01_00146703 predicted 1825
9 SASI_Rn01_00146704 predicted 1581
10 SASI_Rn01_00146705 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097993 predicted 1063
2 SASI_Mm01_00097994 predicted 1976
3 SASI_Mm01_00097995 predicted 893
4 SASI_Mm02_00344746 predicted 480
5 SASI_Mm01_00097997 predicted 2116
6 SASI_Mm01_00097998 predicted 201
7 SASI_Mm02_00344747 predicted 2730
8 SASI_Mm01_00097999 predicted 1979
9 SASI_Mm01_00098000 predicted 1001
10 SASI_Mm01_00098001 predicted 2171
11 SASI_Mm01_00097996 predicted 2222
12 SASI_Mm01_00098002 predicted 1998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004721
VALIDATED
MAP3K13 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 13
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-908s1c1
Sequence:CCGGGCACCCTAACATCATCGCATTCTCGAGAATGCGATGATGTTAGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1523s1c1
Sequence:CCGGCCCACAAGAAACTTACTTCAACTCGAGTTGAAGTAAGTTTCTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1833s1c1
Sequence:CCGGCGTCCTATCATCCATCCCAATCTCGAGATTGGGATGGATGATAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2481s1c1
Sequence:CCGGCCAGAACAGTATGGGTCCTTACTCGAGTAAGGACCCATACTGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1757s21c1
Sequence:CCGGGCGGGAGAAGGAGCTCATTAACTCGAGTTAATGAGCTCCTTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1657s21c1
Sequence:CCGGTCAGGCATGCGCTGGATATTCCTCGAGGAATATCCAGCGCATGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2880s1c1
Sequence:CCGGCCTGATGAGTTAGCTGATAAACTCGAGTTTATCAGCTAACTCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-3189s1c1
Sequence:CCGGCCTGAAGATCTCGTGACTATACTCGAGTATAGTCACGAGATCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1801s21c1
Sequence:GTACCGGAGTATCCTGGGACCTACAAACCTCGAGGTTTGTAGGTCCCAGGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2439s21c1
Sequence:GTACCGGTGTTGCCAGGCTGACGCTTATCTCGAGATAAGCGTCAGCCTGGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-601s1c1
Sequence:CCGGCAAGCGGAACTGAAGACATAACTCGAGTTATGTCTTCAGTTCCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004721.3-3198s1c1
Sequence:CCGGCTCGTGACTATACTGGCATTTCTCGAGAAATGCCAGTATAGTCACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-2797s1c1
Sequence:CCGGGCCAGTCATATTCAACCTTTACTCGAGTAAAGGTTGAATATGACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-710s1c1
Sequence:CCGGGAAGGCATATTCCACTGATTACTCGAGTAATCAGTGGAATATGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-530s1c1
Sequence:CCGGGCTAAGGGAACACGATGAATCCTCGAGGATTCATCGTGTTCCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1104s21c1
Sequence:GTACCGGCGTGATCTCAAATCACCTAATCTCGAGATTAGGTGATTTGAGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2950s21c1
Sequence:GTACCGGCAGAGATTCCCATTGACATATCTCGAGATATGTCAATGGGAATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004721.3-3395s21c1
Sequence:CCGGCAAGAATGGCAGGGATCTATTCTCGAGAATAGATCCCTGCCATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004721
VALIDATED
MAP3K13 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 13
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-908s1c1
Sequence:CCGGGCACCCTAACATCATCGCATTCTCGAGAATGCGATGATGTTAGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1523s1c1
Sequence:CCGGCCCACAAGAAACTTACTTCAACTCGAGTTGAAGTAAGTTTCTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1833s1c1
Sequence:CCGGCGTCCTATCATCCATCCCAATCTCGAGATTGGGATGGATGATAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2481s1c1
Sequence:CCGGCCAGAACAGTATGGGTCCTTACTCGAGTAAGGACCCATACTGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1757s21c1
Sequence:CCGGGCGGGAGAAGGAGCTCATTAACTCGAGTTAATGAGCTCCTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1657s21c1
Sequence:CCGGTCAGGCATGCGCTGGATATTCCTCGAGGAATATCCAGCGCATGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2880s1c1
Sequence:CCGGCCTGATGAGTTAGCTGATAAACTCGAGTTTATCAGCTAACTCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-3189s1c1
Sequence:CCGGCCTGAAGATCTCGTGACTATACTCGAGTATAGTCACGAGATCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1801s21c1
Sequence:GTACCGGAGTATCCTGGGACCTACAAACCTCGAGGTTTGTAGGTCCCAGGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2439s21c1
Sequence:GTACCGGTGTTGCCAGGCTGACGCTTATCTCGAGATAAGCGTCAGCCTGGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-601s1c1
Sequence:CCGGCAAGCGGAACTGAAGACATAACTCGAGTTATGTCTTCAGTTCCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004721.3-3198s1c1
Sequence:CCGGCTCGTGACTATACTGGCATTTCTCGAGAAATGCCAGTATAGTCACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-2797s1c1
Sequence:CCGGGCCAGTCATATTCAACCTTTACTCGAGTAAAGGTTGAATATGACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-710s1c1
Sequence:CCGGGAAGGCATATTCCACTGATTACTCGAGTAATCAGTGGAATATGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-530s1c1
Sequence:CCGGGCTAAGGGAACACGATGAATCCTCGAGGATTCATCGTGTTCCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1104s21c1
Sequence:GTACCGGCGTGATCTCAAATCACCTAATCTCGAGATTAGGTGATTTGAGATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2950s21c1
Sequence:GTACCGGCAGAGATTCCCATTGACATATCTCGAGATATGTCAATGGGAATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004721.3-3395s21c1
Sequence:CCGGCAAGAATGGCAGGGATCTATTCTCGAGAATAGATCCCTGCCATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004721
VALIDATED
MAP3K13 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 13
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-908s1c1
Sequence:CCGGGCACCCTAACATCATCGCATTCTCGAGAATGCGATGATGTTAGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1523s1c1
Sequence:CCGGCCCACAAGAAACTTACTTCAACTCGAGTTGAAGTAAGTTTCTTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-1833s1c1
Sequence:CCGGCGTCCTATCATCCATCCCAATCTCGAGATTGGGATGGATGATAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2481s1c1
Sequence:CCGGCCAGAACAGTATGGGTCCTTACTCGAGTAAGGACCCATACTGTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1757s21c1
Sequence:CCGGGCGGGAGAAGGAGCTCATTAACTCGAGTTAATGAGCTCCTTCTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1657s21c1
Sequence:CCGGTCAGGCATGCGCTGGATATTCCTCGAGGAATATCCAGCGCATGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-2880s1c1
Sequence:CCGGCCTGATGAGTTAGCTGATAAACTCGAGTTTATCAGCTAACTCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-3189s1c1
Sequence:CCGGCCTGAAGATCTCGTGACTATACTCGAGTATAGTCACGAGATCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1801s21c1
Sequence:GTACCGGAGTATCCTGGGACCTACAAACCTCGAGGTTTGTAGGTCCCAGGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2439s21c1
Sequence:GTACCGGTGTTGCCAGGCTGACGCTTATCTCGAGATAAGCGTCAGCCTGGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-601s1c1
Sequence:CCGGCAAGCGGAACTGAAGACATAACTCGAGTTATGTCTTCAGTTCCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004721.3-3198s1c1
Sequence:CCGGCTCGTGACTATACTGGCATTTCTCGAGAAATGCCAGTATAGTCACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-2797s1c1
Sequence:CCGGGCCAGTCATATTCAACCTTTACTCGAGTAAAGGTTGAATATGACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004721.3-710s1c1
Sequence:CCGGGAAGGCATATTCCACTGATTACTCGAGTAATCAGTGGAATATGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004721.3-530s1c1
Sequence:CCGGGCTAAGGGAACACGATGAATCCTCGAGGATTCATCGTGTTCCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-1104s21c1
Sequence:GTACCGGCGTGATCTCAAATCACCTAATCTCGAGATTAGGTGATTTGAGATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004721.3-2950s21c1
Sequence:GTACCGGCAGAGATTCCCATTGACATATCTCGAGATATGTCAATGGGAATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004721.3-3395s21c1
Sequence:CCGGCAAGAATGGCAGGGATCTATTCTCGAGAATAGATCCCTGCCATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172821
MAP3K13 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 13
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1983s21c1
Sequence:CCGGCATTGCAACCTGCGCCAATAACTCGAGTTATTGGCGCAGGTTGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1064s21c1
Sequence:CCGGTGGACTCTTCCGCCATCATTTCTCGAGAAATGATGGCGGAAGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-2577s21c1
Sequence:CCGGCTCGAACAGTCCCGATGAATCCTCGAGGATTCATCGGGACTGTTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172821
MAP3K13 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 13
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1983s21c1
Sequence:CCGGCATTGCAACCTGCGCCAATAACTCGAGTTATTGGCGCAGGTTGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1064s21c1
Sequence:CCGGTGGACTCTTCCGCCATCATTTCTCGAGAAATGATGGCGGAAGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-2577s21c1
Sequence:CCGGCTCGAACAGTCCCGATGAATCCTCGAGGATTCATCGGGACTGTTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172821
MAP3K13 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 13
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1983s21c1
Sequence:CCGGCATTGCAACCTGCGCCAATAACTCGAGTTATTGGCGCAGGTTGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-1064s21c1
Sequence:CCGGTGGACTCTTCCGCCATCATTTCTCGAGAAATGATGGCGGAAGAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172821.3-2577s21c1
Sequence:CCGGCTCGAACAGTCCCGATGAATCCTCGAGGATTCATCGGGACTGTTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484537
MAP3K13 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-623s1c1
Sequence:CCGGCCAGCATTTCTGGTGTCAGTACTCGAGTACTGACACCAGAAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1204s1c1
Sequence:CCGGCCGAATAAATATACTTGGGAACTCGAGTTCCCAAGTATATTTATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-3289s1c1
Sequence:CCGGGCCAATAACCTGAGGTACTTTCTCGAGAAAGTACCTCAGGTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484537.2-5849s1c1
Sequence:CCGGCCCTCCTTTGTTTACACTTTACTCGAGTAAAGTGTAAACAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1378s1c1
Sequence:CCGGCCTAACATCATCGCCTTCAATCTCGAGATTGAAGGCGATGATGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484537
MAP3K13 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-623s1c1
Sequence:CCGGCCAGCATTTCTGGTGTCAGTACTCGAGTACTGACACCAGAAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1204s1c1
Sequence:CCGGCCGAATAAATATACTTGGGAACTCGAGTTCCCAAGTATATTTATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-3289s1c1
Sequence:CCGGGCCAATAACCTGAGGTACTTTCTCGAGAAAGTACCTCAGGTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484537.2-5849s1c1
Sequence:CCGGCCCTCCTTTGTTTACACTTTACTCGAGTAAAGTGTAAACAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1378s1c1
Sequence:CCGGCCTAACATCATCGCCTTCAATCTCGAGATTGAAGGCGATGATGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484537
MAP3K13 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-623s1c1
Sequence:CCGGCCAGCATTTCTGGTGTCAGTACTCGAGTACTGACACCAGAAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1204s1c1
Sequence:CCGGCCGAATAAATATACTTGGGAACTCGAGTTCCCAAGTATATTTATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-3289s1c1
Sequence:CCGGGCCAATAACCTGAGGTACTTTCTCGAGAAAGTACCTCAGGTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484537.2-5849s1c1
Sequence:CCGGCCCTCCTTTGTTTACACTTTACTCGAGTAAAGTGTAAACAAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484537.2-1378s1c1
Sequence:CCGGCCTAACATCATCGCCTTCAATCTCGAGATTGAAGGCGATGATGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)