EMAIL THIS PAGE TO A FRIEND

MAP3K14

mitogen-activated protein kinase kinase kinase 14

128 Gene Product Result for
Synonyms: FTDCR1B HS HSNIK NIK
UniProtKB ID: Q99558, A8K2D8, D3DX67, Q8IYN1
Gene ID:
Human(9020) Summary: This gene encodes mitogen-activated protein kinase kinase kinase 14, which is a serine/threonine protein-kinase. This kinase binds to TRAF2 and stimulates NF-kappaB activity. It shares sequence similarity with several other MAPKK kinases. It participates in an NF-kappaB-inducing signalling cascade common to receptors of the tumour-necrosis/nerve-growth factor (TNF/NGF) family and to the interleukin-1 type-I receptor. [provided by RefSeq, Jul 2008]
Mouse(53859) mitogen-activated protein kinase kinase kinase 14
Rat(360640) mitogen-activated protein kinase kinase kinase 14
chicken(419964) mitogen-activated protein kinase kinase kinase 14
domestic cat(101083468) mitogen-activated protein kinase kinase kinase 14
Horse(100050140) mitogen-activated protein kinase kinase kinase 14
cow(508367) mitogen-activated protein kinase kinase kinase 14
dog(490926) mitogen-activated protein kinase kinase kinase 14
Domestic Rabbit(100351032) mitogen-activated protein kinase kinase kinase 14
naked mole-rat(101703313) mitogen-activated protein kinase kinase kinase 14
domestic guinea pig(100719582) mitogen-activated protein kinase kinase kinase 14
sheep(101118799) mitogen-activated protein kinase kinase kinase 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003954 Rosetta Predictions human pricing
NM_001108301 Rosetta Predictions rat pricing
NM_016896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141408 predicted 2706
2 SASI_Hs01_00141410 predicted 464
3 SASI_Hs01_00141411 predicted 261
4 SASI_Hs01_00141413 predicted 805
5 SASI_Hs01_00141414 predicted 964
6 SASI_Hs01_00141415 predicted 2672
7 SASI_Hs01_00141417 predicted 1706
8 SASI_Hs02_00336622 predicted 1258
9 SASI_Hs02_00336623 predicted 2686
10 SASI_Hs02_00336624 predicted 1012
11 SASI_Hs01_00141409 predicted 652
12 SASI_Hs01_00141412 predicted 2409
13 SASI_Hs01_00141416 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237309 predicted 2623
2 SASI_Rn02_00237310 predicted 2498
3 SASI_Rn02_00237311 predicted 1249
4 SASI_Rn02_00237312 predicted 2076
5 SASI_Rn02_00237313 predicted 1226
6 SASI_Rn02_00237314 predicted 441
7 SASI_Rn02_00237315 predicted 932
8 SASI_Rn02_00237316 predicted 1935
9 SASI_Rn02_00237317 predicted 317
10 SASI_Rn02_00237318 predicted 2531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034249 predicted 2378
2 SASI_Mm01_00034250 predicted 324
3 SASI_Mm01_00034252 predicted 1777
4 SASI_Mm01_00034253 predicted 518
5 SASI_Mm01_00034254 predicted 1252
6 SASI_Mm01_00034255 predicted 434
7 SASI_Mm01_00034256 predicted 2713
8 SASI_Mm01_00034257 predicted 2768
9 SASI_Mm02_00323739 predicted 2751
10 SASI_Mm01_00034258 predicted 1548
11 SASI_Mm01_00034251 predicted 2077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003954
MAP3K14 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 14
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003954.x-4315s1c1
Sequence:CCGGCTCAGGACTCACGTAGCATTACTCGAGTAATGCTACGTGAGTCCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1580s1c1
Sequence:CCGGCCCAGAATTGTCCCTTTGTATCTCGAGATACAAAGGGACAATTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1844s1c1
Sequence:CCGGGCTGTGTGTCTTCAACCTGATCTCGAGATCAGGTTGAAGACACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-487s1c1
Sequence:CCGGGTGTGAGAATAGCCAAGAGTTCTCGAGAACTCTTGGCTATTCTCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-896s1c1
Sequence:CCGGCCTCGATCAGAACTCCACAAACTCGAGTTTGTGGAGTTCTGATCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-478s1c1
Sequence:CCGGCCAGGCTGAGTGTGAGAATAGCTCGAGCTATTCTCACACTCAGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-2799s1c1
Sequence:CCGGGCTATTTCAATGGTGTGAAAGCTCGAGCTTTCACACCATTGAAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-3261s21c1
Sequence:CCGGCGCTTGGATCAGTGACCATTTCTCGAGAAATGGTCACTGATCCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-774s21c1
Sequence:CCGGCTCGATCAGAACTCCACAAACCTCGAGGTTTGTGGAGTTCTGATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2685s21c1
Sequence:GTACCGGATGGTGTGAAAGTCCAAATACCTCGAGGTATTTGGACTTTCACACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-4187s21c1
Sequence:CCGGTCAGGACTCACGTAGCATTAACTCGAGTTAATGCTACGTGAGTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2124s21c1
Sequence:CCGGCAAGACATCCACCGCCAAATCCTCGAGGATTTGGCGGTGGATGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-276s21c1
Sequence:CCGGAGATCCTGAATGACGTGATTACTCGAGTAATCACGTCATTCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2422s21c1
Sequence:CCGGGCAGCTGGAAATAGAATTATTCTCGAGAATAATTCTATTTCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2545s21c1
Sequence:CCGGCCCATCAAAGGCCTCTCAAAGCTCGAGCTTTGAGAGGCCTTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003954
MAP3K14 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 14
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003954.x-4315s1c1
Sequence:CCGGCTCAGGACTCACGTAGCATTACTCGAGTAATGCTACGTGAGTCCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1580s1c1
Sequence:CCGGCCCAGAATTGTCCCTTTGTATCTCGAGATACAAAGGGACAATTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1844s1c1
Sequence:CCGGGCTGTGTGTCTTCAACCTGATCTCGAGATCAGGTTGAAGACACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-487s1c1
Sequence:CCGGGTGTGAGAATAGCCAAGAGTTCTCGAGAACTCTTGGCTATTCTCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-896s1c1
Sequence:CCGGCCTCGATCAGAACTCCACAAACTCGAGTTTGTGGAGTTCTGATCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-478s1c1
Sequence:CCGGCCAGGCTGAGTGTGAGAATAGCTCGAGCTATTCTCACACTCAGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-2799s1c1
Sequence:CCGGGCTATTTCAATGGTGTGAAAGCTCGAGCTTTCACACCATTGAAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-3261s21c1
Sequence:CCGGCGCTTGGATCAGTGACCATTTCTCGAGAAATGGTCACTGATCCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-774s21c1
Sequence:CCGGCTCGATCAGAACTCCACAAACCTCGAGGTTTGTGGAGTTCTGATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2685s21c1
Sequence:GTACCGGATGGTGTGAAAGTCCAAATACCTCGAGGTATTTGGACTTTCACACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-4187s21c1
Sequence:CCGGTCAGGACTCACGTAGCATTAACTCGAGTTAATGCTACGTGAGTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2124s21c1
Sequence:CCGGCAAGACATCCACCGCCAAATCCTCGAGGATTTGGCGGTGGATGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-276s21c1
Sequence:CCGGAGATCCTGAATGACGTGATTACTCGAGTAATCACGTCATTCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2422s21c1
Sequence:CCGGGCAGCTGGAAATAGAATTATTCTCGAGAATAATTCTATTTCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2545s21c1
Sequence:CCGGCCCATCAAAGGCCTCTCAAAGCTCGAGCTTTGAGAGGCCTTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003954
MAP3K14 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 14
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003954.x-4315s1c1
Sequence:CCGGCTCAGGACTCACGTAGCATTACTCGAGTAATGCTACGTGAGTCCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1580s1c1
Sequence:CCGGCCCAGAATTGTCCCTTTGTATCTCGAGATACAAAGGGACAATTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-1844s1c1
Sequence:CCGGGCTGTGTGTCTTCAACCTGATCTCGAGATCAGGTTGAAGACACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-487s1c1
Sequence:CCGGGTGTGAGAATAGCCAAGAGTTCTCGAGAACTCTTGGCTATTCTCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003954.x-896s1c1
Sequence:CCGGCCTCGATCAGAACTCCACAAACTCGAGTTTGTGGAGTTCTGATCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-478s1c1
Sequence:CCGGCCAGGCTGAGTGTGAGAATAGCTCGAGCTATTCTCACACTCAGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003954.1-2799s1c1
Sequence:CCGGGCTATTTCAATGGTGTGAAAGCTCGAGCTTTCACACCATTGAAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-3261s21c1
Sequence:CCGGCGCTTGGATCAGTGACCATTTCTCGAGAAATGGTCACTGATCCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-774s21c1
Sequence:CCGGCTCGATCAGAACTCCACAAACCTCGAGGTTTGTGGAGTTCTGATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2685s21c1
Sequence:GTACCGGATGGTGTGAAAGTCCAAATACCTCGAGGTATTTGGACTTTCACACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003954.2-4187s21c1
Sequence:CCGGTCAGGACTCACGTAGCATTAACTCGAGTTAATGCTACGTGAGTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2124s21c1
Sequence:CCGGCAAGACATCCACCGCCAAATCCTCGAGGATTTGGCGGTGGATGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-276s21c1
Sequence:CCGGAGATCCTGAATGACGTGATTACTCGAGTAATCACGTCATTCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2422s21c1
Sequence:CCGGGCAGCTGGAAATAGAATTATTCTCGAGAATAATTCTATTTCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003954.2-2545s21c1
Sequence:CCGGCCCATCAAAGGCCTCTCAAAGCTCGAGCTTTGAGAGGCCTTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016896
MAP3K14 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 14
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016896.2-3969s1c1
Sequence:CCGGAGCATTAAGTTCACTGTGAATCTCGAGATTCACAGTGAACTTAATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-334s1c1
Sequence:CCGGGCTGAATGTGAGAATAGCCAACTCGAGTTGGCTATTCTCACATTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2078s1c1
Sequence:CCGGGCCCTTGGAAAGGAGAATATACTCGAGTATATTCTCCTTTCCAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-619s1c1
Sequence:CCGGCAGGAAGATGAGTCTCCACTACTCGAGTAGTGGAGACTCATCTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2382s1c1
Sequence:CCGGGCAACTGGAGATAGAACTGTTCTCGAGAACAGTTCTATCTCCAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-1514s21c1
Sequence:CCGGCTCGCTGGGTCAGCTCATAAACTCGAGTTTATGAGCTGACCCAGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-413s21c1
Sequence:CCGGGTCTGAGAGTCTCGATCAAATCTCGAGATTTGATCGAGACTCTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3617s21c1
Sequence:GTACCGGGAACGGTCTGCAAATGATAAACTCGAGTTTATCATTTGCAGACCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-900s21c1
Sequence:CCGGGAGCCCTGGAAACCCTATATGCTCGAGCATATAGGGTTTCCAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-639s21c1
Sequence:CCGGGGCAACCTCTATGCCAGAAATCTCGAGATTTCTGGCATAGAGGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-364s21c1
Sequence:CCGGCCACCTTCTCAGAGCGCATTTCTCGAGAAATGCGCTCTGAGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3059s21c1
Sequence:CCGGCAGCGAAGGGAACAGAGTAAACTCGAGTTTACTCTGTTCCCTTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-2078s21c1
Sequence:CCGGCCCTTGGAAAGGAGAATATAACTCGAGTTATATTCTCCTTTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016896
MAP3K14 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 14
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016896.2-3969s1c1
Sequence:CCGGAGCATTAAGTTCACTGTGAATCTCGAGATTCACAGTGAACTTAATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-334s1c1
Sequence:CCGGGCTGAATGTGAGAATAGCCAACTCGAGTTGGCTATTCTCACATTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2078s1c1
Sequence:CCGGGCCCTTGGAAAGGAGAATATACTCGAGTATATTCTCCTTTCCAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-619s1c1
Sequence:CCGGCAGGAAGATGAGTCTCCACTACTCGAGTAGTGGAGACTCATCTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2382s1c1
Sequence:CCGGGCAACTGGAGATAGAACTGTTCTCGAGAACAGTTCTATCTCCAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-1514s21c1
Sequence:CCGGCTCGCTGGGTCAGCTCATAAACTCGAGTTTATGAGCTGACCCAGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-413s21c1
Sequence:CCGGGTCTGAGAGTCTCGATCAAATCTCGAGATTTGATCGAGACTCTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3617s21c1
Sequence:GTACCGGGAACGGTCTGCAAATGATAAACTCGAGTTTATCATTTGCAGACCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-900s21c1
Sequence:CCGGGAGCCCTGGAAACCCTATATGCTCGAGCATATAGGGTTTCCAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-639s21c1
Sequence:CCGGGGCAACCTCTATGCCAGAAATCTCGAGATTTCTGGCATAGAGGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-364s21c1
Sequence:CCGGCCACCTTCTCAGAGCGCATTTCTCGAGAAATGCGCTCTGAGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3059s21c1
Sequence:CCGGCAGCGAAGGGAACAGAGTAAACTCGAGTTTACTCTGTTCCCTTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-2078s21c1
Sequence:CCGGCCCTTGGAAAGGAGAATATAACTCGAGTTATATTCTCCTTTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016896
MAP3K14 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 14
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016896.2-3969s1c1
Sequence:CCGGAGCATTAAGTTCACTGTGAATCTCGAGATTCACAGTGAACTTAATGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-334s1c1
Sequence:CCGGGCTGAATGTGAGAATAGCCAACTCGAGTTGGCTATTCTCACATTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2078s1c1
Sequence:CCGGGCCCTTGGAAAGGAGAATATACTCGAGTATATTCTCCTTTCCAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-619s1c1
Sequence:CCGGCAGGAAGATGAGTCTCCACTACTCGAGTAGTGGAGACTCATCTTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016896.2-2382s1c1
Sequence:CCGGGCAACTGGAGATAGAACTGTTCTCGAGAACAGTTCTATCTCCAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-1514s21c1
Sequence:CCGGCTCGCTGGGTCAGCTCATAAACTCGAGTTTATGAGCTGACCCAGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-413s21c1
Sequence:CCGGGTCTGAGAGTCTCGATCAAATCTCGAGATTTGATCGAGACTCTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3617s21c1
Sequence:GTACCGGGAACGGTCTGCAAATGATAAACTCGAGTTTATCATTTGCAGACCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-900s21c1
Sequence:CCGGGAGCCCTGGAAACCCTATATGCTCGAGCATATAGGGTTTCCAGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-639s21c1
Sequence:CCGGGGCAACCTCTATGCCAGAAATCTCGAGATTTCTGGCATAGAGGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-364s21c1
Sequence:CCGGCCACCTTCTCAGAGCGCATTTCTCGAGAAATGCGCTCTGAGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016896.3-3059s21c1
Sequence:CCGGCAGCGAAGGGAACAGAGTAAACTCGAGTTTACTCTGTTCCCTTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016896.3-2078s21c1
Sequence:CCGGCCCTTGGAAAGGAGAATATAACTCGAGTTATATTCTCCTTTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)