EMAIL THIS PAGE TO A FRIEND

MAP3K19

mitogen-activated protein kinase kinase kinase 19

146 Gene Product Result for
Synonyms: RCK YSK4
Gene ID:
Mouse(22625) mitogen-activated protein kinase kinase kinase 19
Rat(289001) mitogen-activated protein kinase kinase kinase 19
naked mole-rat(101725578) mitogen-activated protein kinase kinase kinase 19
domestic guinea pig(100733643) mitogen-activated protein kinase kinase kinase 19
sheep(101106493) mitogen-activated protein kinase kinase kinase 19
Zebrafish(572217) mitogen-activated protein kinase kinase kinase 19
domestic cat(101090454) mitogen-activated protein kinase kinase kinase 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070721 MISSION® esiRNA esiRNA human YSK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018046 Rosetta Predictions human pricing
NM_025052 Rosetta Predictions human pricing
XM_222618 Rosetta Predictions rat pricing
XR_007575 Rosetta Predictions rat pricing
XM_914055 Rosetta Predictions mouse pricing
XM_988355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134200 predicted 1233
2 SASI_Hs01_00134201 predicted 1331
3 SASI_Hs01_00134203 predicted 1142
4 SASI_Hs01_00134204 predicted 1331
5 SASI_Hs01_00134206 predicted 923
6 SASI_Hs02_00306935 predicted 1335
7 SASI_Hs01_00134207 predicted 1299
8 SASI_Hs01_00134208 predicted 1432
9 SASI_Hs02_00306936 predicted 1009
10 SASI_Hs02_00306937 predicted 1141
11 SASI_Hs01_00134202 predicted 1120
12 SASI_Hs01_00134205 predicted 1060
13 SASI_Hs01_00134209 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215967 predicted 3688
2 SASI_Hs01_00215968 predicted 3790
3 SASI_Hs01_00215970 predicted 3590
4 SASI_Hs01_00215971 predicted 3779
5 SASI_Hs01_00215973 predicted 3377
6 SASI_Hs02_00357701 predicted 3787
7 SASI_Hs01_00215974 predicted 3753
8 SASI_Hs01_00215975 predicted 3883
9 SASI_Hs02_00357702 predicted 3467
10 SASI_Hs02_00357703 predicted 3592
11 SASI_Hs01_00215969 predicted 3574
12 SASI_Hs01_00215972 predicted 3519
13 SASI_Hs01_00215976 predicted 3430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158272 predicted 438
2 SASI_Rn01_00158273 predicted 348
3 SASI_Rn01_00158274 predicted 356
4 SASI_Rn01_00158275 predicted 420
5 SASI_Rn01_00158276 predicted 299
6 SASI_Rn01_00158277 predicted 411
7 SASI_Rn01_00158278 predicted 291
8 SASI_Rn01_00158279 predicted 445
9 SASI_Rn01_00158280 predicted 456
10 SASI_Rn01_00158281 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188583 predicted 212
2 SASI_Rn02_00414948 predicted 1429
3 SASI_Rn02_00414949 predicted 1219
4 SASI_Rn02_00414950 predicted 1139
5 SASI_Rn02_00414951 predicted 270
6 SASI_Rn02_00414952 predicted 945
7 SASI_Rn01_00188587 predicted 402
8 SASI_Rn02_00414953 predicted 941
9 SASI_Rn01_00188589 predicted 333
10 SASI_Rn02_00414954 predicted 974
11 SASI_Rn01_00188582 predicted 372
12 SASI_Rn01_00188584 predicted 278
13 SASI_Rn01_00188585 predicted 402
14 SASI_Rn01_00188586 predicted 261
15 SASI_Rn01_00188588 predicted 408
16 SASI_Rn01_00188590 predicted 306
17 SASI_Rn01_00188591 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438284 predicted 3135
2 SASI_Mm02_00438285 predicted 1769
3 SASI_Mm02_00438286 predicted 3481
4 SASI_Mm02_00438287 predicted 2381
5 SASI_Mm02_00438288 predicted 1576
6 SASI_Mm02_00438289 predicted 3580
7 SASI_Mm02_00438290 predicted 240
8 SASI_Mm02_00438291 predicted 2781
9 SASI_Mm02_00438292 predicted 4001
10 SASI_Mm02_00438293 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248295 predicted 2187
2 SASI_Mm01_00248296 predicted 3139
3 SASI_Mm01_00248297 predicted 1781
4 SASI_Mm01_00248298 predicted 2088
5 SASI_Mm01_00248299 predicted 3335
6 SASI_Mm01_00248300 predicted 3481
7 SASI_Mm01_00248301 predicted 378
8 SASI_Mm01_00248302 predicted 2382
9 SASI_Mm01_00248303 predicted 248
10 SASI_Mm01_00248304 predicted 2792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025052
MAP3K19 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-2076s21c1
Sequence:CCGGACACGTATTACCGTGAGATATCTCGAGATATCTCACGGTAATACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-104s1c1
Sequence:CCGGCCAACTGATTTGATGACAGTTCTCGAGAACTGTCATCAAATCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-2112s1c1
Sequence:CCGGGCAGACGTATCACCAATAAATCTCGAGATTTATTGGTGATACGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-1931s21c1
Sequence:CCGGCCGACAGAGCCAAGACTAAATCTCGAGATTTAGTCTTGGCTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-3466s21c1
Sequence:CCGGTGGCTCAATCTCTAGTATTATCTCGAGATAATACTAGAGATTGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-665s1c1
Sequence:CCGGGAGCATTGGTTGTACTGTGTTCTCGAGAACACAGTACAACCAATGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-636s1c1
Sequence:CCGGTCTGGCTATGGACGGAAATCACTCGAGTGATTTCCGTCCATAGCCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-392s1c1
Sequence:CCGGGATGGTGTTCTGTAAATATACCTCGAGGTATATTTACAGAACACCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-666s1c1
Sequence:CCGGAGCATTGGTTGTACTGTGTTTCTCGAGAAACACAGTACAACCAATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025052.x-1474s1c1
Sequence:CCGGCTAGTTAAAGTGTGTATCCATCTCGAGATGGATACACACTTTAACTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025052
MAP3K19 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-2076s21c1
Sequence:CCGGACACGTATTACCGTGAGATATCTCGAGATATCTCACGGTAATACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-104s1c1
Sequence:CCGGCCAACTGATTTGATGACAGTTCTCGAGAACTGTCATCAAATCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-2112s1c1
Sequence:CCGGGCAGACGTATCACCAATAAATCTCGAGATTTATTGGTGATACGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-1931s21c1
Sequence:CCGGCCGACAGAGCCAAGACTAAATCTCGAGATTTAGTCTTGGCTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-3466s21c1
Sequence:CCGGTGGCTCAATCTCTAGTATTATCTCGAGATAATACTAGAGATTGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-665s1c1
Sequence:CCGGGAGCATTGGTTGTACTGTGTTCTCGAGAACACAGTACAACCAATGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-636s1c1
Sequence:CCGGTCTGGCTATGGACGGAAATCACTCGAGTGATTTCCGTCCATAGCCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-392s1c1
Sequence:CCGGGATGGTGTTCTGTAAATATACCTCGAGGTATATTTACAGAACACCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-666s1c1
Sequence:CCGGAGCATTGGTTGTACTGTGTTTCTCGAGAAACACAGTACAACCAATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025052.x-1474s1c1
Sequence:CCGGCTAGTTAAAGTGTGTATCCATCTCGAGATGGATACACACTTTAACTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025052
MAP3K19 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-2076s21c1
Sequence:CCGGACACGTATTACCGTGAGATATCTCGAGATATCTCACGGTAATACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-104s1c1
Sequence:CCGGCCAACTGATTTGATGACAGTTCTCGAGAACTGTCATCAAATCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.3-2112s1c1
Sequence:CCGGGCAGACGTATCACCAATAAATCTCGAGATTTATTGGTGATACGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-1931s21c1
Sequence:CCGGCCGACAGAGCCAAGACTAAATCTCGAGATTTAGTCTTGGCTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025052.3-3466s21c1
Sequence:CCGGTGGCTCAATCTCTAGTATTATCTCGAGATAATACTAGAGATTGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-665s1c1
Sequence:CCGGGAGCATTGGTTGTACTGTGTTCTCGAGAACACAGTACAACCAATGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-636s1c1
Sequence:CCGGTCTGGCTATGGACGGAAATCACTCGAGTGATTTCCGTCCATAGCCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-392s1c1
Sequence:CCGGGATGGTGTTCTGTAAATATACCTCGAGGTATATTTACAGAACACCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025052.x-666s1c1
Sequence:CCGGAGCATTGGTTGTACTGTGTTTCTCGAGAAACACAGTACAACCAATGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025052.x-1474s1c1
Sequence:CCGGCTAGTTAAAGTGTGTATCCATCTCGAGATGGATACACACTTTAACTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011737
MAP3K19 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-152s21c1
Sequence:CCGGATGACTTCAGCCCGTTCATATCTCGAGATATGAACGGGCTGAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3031s21c1
Sequence:CCGGATTAATGGATTCCGGATATATCTCGAGATATATCCGGAATCCATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3528s21c1
Sequence:CCGGGCTCATGCCAACGGGAATAATCTCGAGATTATTCCCGTTGGCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-2058s21c1
Sequence:CCGGAGGCCGATGTGTCGTTAATAACTCGAGTTATTAACGACACATCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3384s21c1
Sequence:CCGGTGGTTCCATCTCTAGTATAATCTCGAGATTATACTAGAGATGGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011737
MAP3K19 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-152s21c1
Sequence:CCGGATGACTTCAGCCCGTTCATATCTCGAGATATGAACGGGCTGAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3031s21c1
Sequence:CCGGATTAATGGATTCCGGATATATCTCGAGATATATCCGGAATCCATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3528s21c1
Sequence:CCGGGCTCATGCCAACGGGAATAATCTCGAGATTATTCCCGTTGGCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-2058s21c1
Sequence:CCGGAGGCCGATGTGTCGTTAATAACTCGAGTTATTAACGACACATCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3384s21c1
Sequence:CCGGTGGTTCCATCTCTAGTATAATCTCGAGATTATACTAGAGATGGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011737
MAP3K19 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-152s21c1
Sequence:CCGGATGACTTCAGCCCGTTCATATCTCGAGATATGAACGGGCTGAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3031s21c1
Sequence:CCGGATTAATGGATTCCGGATATATCTCGAGATATATCCGGAATCCATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3528s21c1
Sequence:CCGGGCTCATGCCAACGGGAATAATCTCGAGATTATTCCCGTTGGCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-2058s21c1
Sequence:CCGGAGGCCGATGTGTCGTTAATAACTCGAGTTATTAACGACACATCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011737.1-3384s21c1
Sequence:CCGGTGGTTCCATCTCTAGTATAATCTCGAGATTATACTAGAGATGGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)