EMAIL THIS PAGE TO A FRIEND

MAP3K2

mitogen-activated protein kinase kinase kinase 2

241 Gene Product Result for
Synonyms: MEKK2 MEKK2B
Gene ID:
Human(10746) Summary: The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase preferentially activates other kinases involved in the MAP kinase signaling pathway. This kinase has been shown to directly phosphorylate and activate Ikappa B kinases, and thus plays a role in NF-kappa B signaling pathway. This kinase has also been found to bind and activate protein kinase C-related kinase 2, which suggests its involvement in a regulated signaling process. [provided by RefSeq, Jul 2008]
Mouse(26405) mitogen-activated protein kinase kinase kinase 2
Rat(171492) mitogen activated protein kinase kinase kinase 2
Zebrafish(558321) mitogen-activated protein kinase kinase kinase 2
chicken(424225) mitogen-activated protein kinase kinase kinase 2
domestic cat(101096406) mitogen-activated protein kinase kinase kinase 2
Horse(100050628) mitogen-activated protein kinase kinase kinase 2
cow(504592) mitogen-activated protein kinase kinase kinase 2
dog(612902) mitogen-activated protein kinase kinase kinase 2
sheep(101109858) mitogen-activated protein kinase kinase kinase 2
domestic guinea pig(100723690) mitogen-activated protein kinase kinase kinase 2
naked mole-rat(101726195) mitogen-activated protein kinase kinase kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006609 Rosetta Predictions human pricing
XM_001059840 Rosetta Predictions rat pricing
XM_001067270 Rosetta Predictions rat pricing
NM_011946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048800 predicted 514
2 SASI_Hs01_00048801 predicted 1065
3 SASI_Hs02_00341939 predicted 1467
4 SASI_Hs02_00341940 predicted 240
5 SASI_Hs01_00048802 predicted 890
6 SASI_Hs01_00048803 predicted 294
7 SASI_Hs01_00048804 predicted 434
8 SASI_Hs01_00048805 predicted 1173
9 SASI_Hs01_00048806 predicted 1691
10 SASI_Hs01_00048807 predicted 430
11 SASI_Hs01_00048808 predicted 1829
12 SASI_Hs01_00048809 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294537 predicted 1228
2 SASI_Rn02_00294538 predicted 1024
3 SASI_Rn02_00294539 predicted 1949
4 SASI_Rn02_00294540 predicted 1307
5 SASI_Rn02_00294541 predicted 732
6 SASI_Rn02_00294542 predicted 1964
7 SASI_Rn02_00294543 predicted 1838
8 SASI_Rn02_00294544 predicted 1319
9 SASI_Rn02_00294545 predicted 2271
10 SASI_Rn02_00294546 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320466 predicted 1225
2 SASI_Rn02_00320467 predicted 1735
3 SASI_Rn02_00320468 predicted 1030
4 SASI_Rn02_00320469 predicted 833
5 SASI_Rn02_00320470 predicted 1954
6 SASI_Rn02_00320471 predicted 1301
7 SASI_Rn02_00320472 predicted 1966
8 SASI_Rn02_00320473 predicted 1830
9 SASI_Rn02_00320474 predicted 1310
10 SASI_Rn02_00320475 predicted 2279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103973 predicted 696
2 SASI_Mm01_00103974 predicted 1481
3 SASI_Mm01_00103975 predicted 1241
4 SASI_Mm02_00321806 predicted 1762
5 SASI_Mm01_00103976 predicted 906
6 SASI_Mm01_00103977 predicted 2007
7 SASI_Mm01_00103979 predicted 868
8 SASI_Mm01_00103980 predicted 2149
9 SASI_Mm01_00103981 predicted 1850
10 SASI_Mm01_00103982 predicted 1129
11 SASI_Mm01_00103978 predicted 2173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006609
VALIDATED
MAP3K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-3032s1c1
Sequence:CCGGCAGAATACTAAAGCACCTCAACTCGAGTTGAGGTGCTTTAGTATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-768s1c1
Sequence:CCGGCCTTTGGATGGAGAGAGCTATCTCGAGATAGCTCTCTCCATCCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-913s1c1
Sequence:CCGGCATATCATCATCAAGAGGTAACTCGAGTTACCTCTTGATGATGATATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-612s1c1
Sequence:CCGGCCAGATGAATTACACCAGGTTCTCGAGAACCTGGTGTAATTCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-1588s1c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-4180s1c1
Sequence:CCGGCCCAAGTGTGTGGATCTATTACTCGAGTAATAGATCCACACACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1067s1c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006609.3-4004s1c1
Sequence:CCGGGCATTCCCTGTAGGAATATTTCTCGAGAAATATTCCTACAGGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1024s1c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-997s1c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-375s1c1
Sequence:CCGGGAACTGCTGGATCGTAGTATTCTCGAGAATACTACGATCCAGCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1024s21c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-997s21c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1549s21c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1067s21c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006609
VALIDATED
MAP3K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-3032s1c1
Sequence:CCGGCAGAATACTAAAGCACCTCAACTCGAGTTGAGGTGCTTTAGTATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-768s1c1
Sequence:CCGGCCTTTGGATGGAGAGAGCTATCTCGAGATAGCTCTCTCCATCCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-913s1c1
Sequence:CCGGCATATCATCATCAAGAGGTAACTCGAGTTACCTCTTGATGATGATATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-612s1c1
Sequence:CCGGCCAGATGAATTACACCAGGTTCTCGAGAACCTGGTGTAATTCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-1588s1c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-4180s1c1
Sequence:CCGGCCCAAGTGTGTGGATCTATTACTCGAGTAATAGATCCACACACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1067s1c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006609.3-4004s1c1
Sequence:CCGGGCATTCCCTGTAGGAATATTTCTCGAGAAATATTCCTACAGGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1024s1c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-997s1c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-375s1c1
Sequence:CCGGGAACTGCTGGATCGTAGTATTCTCGAGAATACTACGATCCAGCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1024s21c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-997s21c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1549s21c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1067s21c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006609
VALIDATED
MAP3K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-3032s1c1
Sequence:CCGGCAGAATACTAAAGCACCTCAACTCGAGTTGAGGTGCTTTAGTATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-768s1c1
Sequence:CCGGCCTTTGGATGGAGAGAGCTATCTCGAGATAGCTCTCTCCATCCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006609.x-913s1c1
Sequence:CCGGCATATCATCATCAAGAGGTAACTCGAGTTACCTCTTGATGATGATATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-612s1c1
Sequence:CCGGCCAGATGAATTACACCAGGTTCTCGAGAACCTGGTGTAATTCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.x-1588s1c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-4180s1c1
Sequence:CCGGCCCAAGTGTGTGGATCTATTACTCGAGTAATAGATCCACACACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1067s1c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006609.3-4004s1c1
Sequence:CCGGGCATTCCCTGTAGGAATATTTCTCGAGAAATATTCCTACAGGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-1024s1c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-997s1c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006609.3-375s1c1
Sequence:CCGGGAACTGCTGGATCGTAGTATTCTCGAGAATACTACGATCCAGCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1024s21c1
Sequence:CCGGAGTATGATGATAGTCGAATAACTCGAGTTATTCGACTATCATCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-997s21c1
Sequence:CCGGGTAGTGGAAGCAGTATCTTTACTCGAGTAAAGATACTGCTTCCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1549s21c1
Sequence:CCGGGCAACGTCAAACTAGGAGATTCTCGAGAATCTCCTAGTTTGACGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006609.3-1067s21c1
Sequence:CCGGCAATCCTACTTTGACCGTAATCTCGAGATTACGGTCAAAGTAGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011946
VALIDATED
MAP3K2 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011946.3-1342s21c1
Sequence:CCGGTATCATCACCAGGAGTATAATCTCGAGATTATACTCCTGGTGATGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-937s1c1
Sequence:CCGGCCAGACATACTACACCAGATTCTCGAGAATCTGGTGTAGTATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-1147s1c1
Sequence:CCGGCCAGATAATCATCAGGAGTTTCTCGAGAAACTCCTGATGATTATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-2173s1c1
Sequence:CCGGCCACCTCATGTCTCAGACTATCTCGAGATAGTCTGAGACATGAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-827s1c1
Sequence:CCGGCGTCACCAGAAGATTTGAATACTCGAGTATTCAAATCTTCTGGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-1573s1c1
Sequence:CCGGGCTGTTAAGCAAGTTCAGTTTCTCGAGAAACTGAACTTGCTTAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-897s21c1
Sequence:CCGGGAGTACACAGGCTACTAATTTCTCGAGAAATTAGTAGCCTGTGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-1487s21c1
Sequence:CCGGAGTATGACGACAGTCGAATAACTCGAGTTATTCGACTGTCGTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011946
VALIDATED
MAP3K2 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011946.3-1342s21c1
Sequence:CCGGTATCATCACCAGGAGTATAATCTCGAGATTATACTCCTGGTGATGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-937s1c1
Sequence:CCGGCCAGACATACTACACCAGATTCTCGAGAATCTGGTGTAGTATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-1147s1c1
Sequence:CCGGCCAGATAATCATCAGGAGTTTCTCGAGAAACTCCTGATGATTATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-2173s1c1
Sequence:CCGGCCACCTCATGTCTCAGACTATCTCGAGATAGTCTGAGACATGAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-827s1c1
Sequence:CCGGCGTCACCAGAAGATTTGAATACTCGAGTATTCAAATCTTCTGGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-1573s1c1
Sequence:CCGGGCTGTTAAGCAAGTTCAGTTTCTCGAGAAACTGAACTTGCTTAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-897s21c1
Sequence:CCGGGAGTACACAGGCTACTAATTTCTCGAGAAATTAGTAGCCTGTGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-1487s21c1
Sequence:CCGGAGTATGACGACAGTCGAATAACTCGAGTTATTCGACTGTCGTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011946
VALIDATED
MAP3K2 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011946.3-1342s21c1
Sequence:CCGGTATCATCACCAGGAGTATAATCTCGAGATTATACTCCTGGTGATGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-937s1c1
Sequence:CCGGCCAGACATACTACACCAGATTCTCGAGAATCTGGTGTAGTATGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-1147s1c1
Sequence:CCGGCCAGATAATCATCAGGAGTTTCTCGAGAAACTCCTGATGATTATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-2173s1c1
Sequence:CCGGCCACCTCATGTCTCAGACTATCTCGAGATAGTCTGAGACATGAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011946.1-827s1c1
Sequence:CCGGCGTCACCAGAAGATTTGAATACTCGAGTATTCAAATCTTCTGGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011946.1-1573s1c1
Sequence:CCGGGCTGTTAAGCAAGTTCAGTTTCTCGAGAAACTGAACTTGCTTAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-897s21c1
Sequence:CCGGGAGTACACAGGCTACTAATTTCTCGAGAAATTAGTAGCCTGTGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011946.3-1487s21c1
Sequence:CCGGAGTATGACGACAGTCGAATAACTCGAGTTATTCGACTGTCGTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)