EMAIL THIS PAGE TO A FRIEND

MAP3K3

mitogen-activated protein kinase kinase kinase 3

215 Gene Product Result for
Synonyms: MAPKKK3 MEKK3
UniProtKB ID: Q99759, B2RCW2, D3DU15, Q5BKZ6, Q8N3I9
Gene ID:
Human(4215) Summary: This gene product is a 626-amino acid polypeptide that is 96.5% identical to mouse Mekk3. Its catalytic domain is closely related to those of several other kinases, including mouse Mekk2, tobacco NPK, and yeast Ste11. Northern blot analysis revealed a 4.6-kb transcript that appears to be ubiquitously expressed. This protein directly regulates the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by activating SEK and MEK1/2 respectively; it does not regulate the p38 pathway. In cotransfection assays, it enhanced transcription from a nuclear factor kappa-B (NFKB)-dependent reporter gene, consistent with a role in the SAPK pathway. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(26406) mitogen-activated protein kinase kinase kinase 3
Rat(303604) mitogen activated protein kinase kinase kinase 3
naked mole-rat(101704335) mitogen-activated protein kinase kinase kinase 3
domestic guinea pig(100731994) mitogen-activated protein kinase kinase kinase 3
sheep(101122537) mitogen-activated protein kinase kinase kinase 3
Zebrafish(560211) mitogen-activated protein kinase kinase kinase 3
chicken(419954) mitogen-activated protein kinase kinase kinase 3
domestic cat(101083633) mitogen-activated protein kinase kinase kinase 3
cow(508943) mitogen-activated protein kinase kinase kinase 3
Horse(100064751) mitogen-activated protein kinase kinase kinase 3
dog(480481) mitogen-activated protein kinase kinase kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406116 Anti-MAP3K3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701921 Anti-map3k3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB1401242 Anti-MAP3K3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
HPA035411 Anti-MAP3K3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501863 Anti-MAP3K3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA035410 Anti-MAP3K3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1300960 Anti-MEKK3 (center) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300961 Anti-MEKK3 (N-term E29) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300428 Anti-MEKK3 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA pricing
SAB1302489 ANTI-MOUSE MAP3K3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1402269 Monoclonal Anti-MAP3K3 antibody produced in mouse clone 1H3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002401 siRNAs that have been validated in the lab human pricing
NM_203351 Rosetta Predictions human pricing
NM_001107058 Rosetta Predictions rat pricing
NM_011947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002401 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047592 validated 2497
1 SASI_Hs01_00047591 validated 1069
2 SASI_Hs01_00047590 predicted 1616
3 SASI_Hs01_00047593 predicted 1095
4 SASI_Hs01_00047594 predicted 1217
5 SASI_Hs01_00047595 predicted 1086
6 SASI_Hs01_00047596 predicted 1766
7 SASI_Hs01_00047597 predicted 1480
8 SASI_Hs01_00047598 predicted 923
9 SASI_Hs01_00047599 predicted 666
10 SASI_Hs02_00333772 predicted 1171
11 SASI_Hs02_00333773 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205825 predicted 1707
2 SASI_Hs01_00205828 predicted 1193
3 SASI_Hs01_00205829 predicted 1304
4 SASI_Hs01_00205830 predicted 1175
5 SASI_Hs01_00205831 predicted 1861
6 SASI_Hs01_00205832 predicted 1569
7 SASI_Hs01_00205833 predicted 1013
8 SASI_Hs01_00205834 predicted 752
9 SASI_Hs02_00373288 predicted 1268
10 SASI_Hs02_00373289 predicted 2022
11 SASI_Hs01_00205826 predicted 1171
12 SASI_Hs01_00205827 predicted 2595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225076 predicted 1470
2 SASI_Rn02_00225077 predicted 512
3 SASI_Rn02_00225078 predicted 631
4 SASI_Rn02_00225079 predicted 847
5 SASI_Rn02_00225080 predicted 1128
6 SASI_Rn02_00225081 predicted 1083
7 SASI_Rn02_00225082 predicted 1448
8 SASI_Rn02_00225083 predicted 577
9 SASI_Rn02_00225084 predicted 2160
10 SASI_Rn02_00225085 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321807 predicted 1212
2 SASI_Mm01_00153628 predicted 617
3 SASI_Mm02_00321808 predicted 372
4 SASI_Mm01_00153629 predicted 821
5 SASI_Mm01_00153631 predicted 563
6 SASI_Mm01_00153633 predicted 839
7 SASI_Mm02_00321809 predicted 1443
8 SASI_Mm02_00321810 predicted 1188
9 SASI_Mm01_00153634 predicted 968
10 SASI_Mm02_00321811 predicted 1440
11 SASI_Mm01_00153630 predicted 840
12 SASI_Mm01_00153632 predicted 1993
13 SASI_Mm01_00153635 predicted 888
14 SASI_Mm01_00153636 predicted 1335
15 SASI_Mm01_00153637 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011947
VALIDATED
MAP3K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-376s1c1
Sequence:CCGGGCCTTAGGATACTACTGTTATCTCGAGATAACAGTAGTATCCTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-882s1c1
Sequence:CCGGCATCACAAAGACTACAATGATCTCGAGATCATTGTAGTCTTTGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1348s1c1
Sequence:CCGGTCACCATCTTTATGGAGTATACTCGAGTATACTCCATAAAGATGGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1473s1c1
Sequence:CCGGCACAGCAACATGATTGTGCATCTCGAGATGCACAATCATGTTGCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-824s1c1
Sequence:CCGGGCTCTATGATAAAGGTGTCAACTCGAGTTGACACCTTTATCATAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-963s21c1
Sequence:CCGGGTCGCTCCTTGAGCACAAATGCTCGAGCATTTGTGCTCAAGGAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011947.3-1092s21c1
Sequence:CCGGCTCCTAGTGCTCCCATCAATTCTCGAGAATTGATGGGAGCACTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2113s21c1
Sequence:CCGGCTGTAAGACCCAAGAGCTTTACTCGAGTAAAGCTCTTGGGTCTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-1820s21c1
Sequence:CCGGGACTTCCTGAGGCGCATATTTCTCGAGAAATATGCGCCTCAGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-926s21c1
Sequence:CCGGCGGCATCAAGGCAACCTATTCCTCGAGGAATAGGTTGCCTTGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2496s21c1
Sequence:CCGGAGGAGGAGCTACTCGGATAAGCTCGAGCTTATCCGAGTAGCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-813s21c1
Sequence:CCGGAGACCCAGCTCTATGATAAAGCTCGAGCTTTATCATAGAGCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-327s21c1
Sequence:CCGGTCGATAAAGCCATTGACATTTCTCGAGAAATGTCAATGGCTTTATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011947
VALIDATED
MAP3K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-376s1c1
Sequence:CCGGGCCTTAGGATACTACTGTTATCTCGAGATAACAGTAGTATCCTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-882s1c1
Sequence:CCGGCATCACAAAGACTACAATGATCTCGAGATCATTGTAGTCTTTGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1348s1c1
Sequence:CCGGTCACCATCTTTATGGAGTATACTCGAGTATACTCCATAAAGATGGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1473s1c1
Sequence:CCGGCACAGCAACATGATTGTGCATCTCGAGATGCACAATCATGTTGCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-824s1c1
Sequence:CCGGGCTCTATGATAAAGGTGTCAACTCGAGTTGACACCTTTATCATAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-963s21c1
Sequence:CCGGGTCGCTCCTTGAGCACAAATGCTCGAGCATTTGTGCTCAAGGAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011947.3-1092s21c1
Sequence:CCGGCTCCTAGTGCTCCCATCAATTCTCGAGAATTGATGGGAGCACTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2113s21c1
Sequence:CCGGCTGTAAGACCCAAGAGCTTTACTCGAGTAAAGCTCTTGGGTCTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-1820s21c1
Sequence:CCGGGACTTCCTGAGGCGCATATTTCTCGAGAAATATGCGCCTCAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-926s21c1
Sequence:CCGGCGGCATCAAGGCAACCTATTCCTCGAGGAATAGGTTGCCTTGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2496s21c1
Sequence:CCGGAGGAGGAGCTACTCGGATAAGCTCGAGCTTATCCGAGTAGCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-813s21c1
Sequence:CCGGAGACCCAGCTCTATGATAAAGCTCGAGCTTTATCATAGAGCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-327s21c1
Sequence:CCGGTCGATAAAGCCATTGACATTTCTCGAGAAATGTCAATGGCTTTATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011947
VALIDATED
MAP3K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-376s1c1
Sequence:CCGGGCCTTAGGATACTACTGTTATCTCGAGATAACAGTAGTATCCTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-882s1c1
Sequence:CCGGCATCACAAAGACTACAATGATCTCGAGATCATTGTAGTCTTTGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1348s1c1
Sequence:CCGGTCACCATCTTTATGGAGTATACTCGAGTATACTCCATAAAGATGGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011947.1-1473s1c1
Sequence:CCGGCACAGCAACATGATTGTGCATCTCGAGATGCACAATCATGTTGCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011947.1-824s1c1
Sequence:CCGGGCTCTATGATAAAGGTGTCAACTCGAGTTGACACCTTTATCATAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-963s21c1
Sequence:CCGGGTCGCTCCTTGAGCACAAATGCTCGAGCATTTGTGCTCAAGGAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011947.3-1092s21c1
Sequence:CCGGCTCCTAGTGCTCCCATCAATTCTCGAGAATTGATGGGAGCACTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2113s21c1
Sequence:CCGGCTGTAAGACCCAAGAGCTTTACTCGAGTAAAGCTCTTGGGTCTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-1820s21c1
Sequence:CCGGGACTTCCTGAGGCGCATATTTCTCGAGAAATATGCGCCTCAGGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-926s21c1
Sequence:CCGGCGGCATCAAGGCAACCTATTCCTCGAGGAATAGGTTGCCTTGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-2496s21c1
Sequence:CCGGAGGAGGAGCTACTCGGATAAGCTCGAGCTTATCCGAGTAGCTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-813s21c1
Sequence:CCGGAGACCCAGCTCTATGATAAAGCTCGAGCTTTATCATAGAGCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011947.3-327s21c1
Sequence:CCGGTCGATAAAGCCATTGACATTTCTCGAGAAATGTCAATGGCTTTATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002401
VALIDATED
MAP3K3 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-320s1c1
Sequence:CCGGACCTCTTGATCTACATTACATCTCGAGATGTAATGTAGATCAAGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-850s1c1
Sequence:CCGGAGGAATACTCAGATCGGGAAACTCGAGTTTCCCGATCTGAGTATTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-2324s1c1
Sequence:CCGGCCAGGGTATGAAGAGTGTTATCTCGAGATAACACTCTTCATACCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002401.x-1313s1c1
Sequence:CCGGGTGCGAGATCCAGTTGCTAAACTCGAGTTTAGCAACTGGATCTCGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-267s1c1
Sequence:CCGGCGGCCTGTGAAATATGAAGATCTCGAGATCTTCATATTTCACAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1216s1c1
Sequence:CCGGGCGTCATCAAGGCAACTTGTTCTCGAGAACAAGTTGCCTTGATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4453s1c1
Sequence:CCGGGCCGTCACTTTCTCATCATTCCTCGAGGAATGATGAGAAAGTGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4316s1c1
Sequence:CCGGGACCAAGTTGTTGCTTAATTTCTCGAGAAATTAAGCAACAACTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1770s1c1
Sequence:CCGGTGATTGTTCACCGGGACATTACTCGAGTAATGTCCCGGTGAACAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1432s1c1
Sequence:CCGGTGCCTTCGGCAGGGTCTATTTCTCGAGAAATAGACCCTGCCGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002401
VALIDATED
MAP3K3 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-320s1c1
Sequence:CCGGACCTCTTGATCTACATTACATCTCGAGATGTAATGTAGATCAAGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-850s1c1
Sequence:CCGGAGGAATACTCAGATCGGGAAACTCGAGTTTCCCGATCTGAGTATTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-2324s1c1
Sequence:CCGGCCAGGGTATGAAGAGTGTTATCTCGAGATAACACTCTTCATACCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002401.x-1313s1c1
Sequence:CCGGGTGCGAGATCCAGTTGCTAAACTCGAGTTTAGCAACTGGATCTCGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-267s1c1
Sequence:CCGGCGGCCTGTGAAATATGAAGATCTCGAGATCTTCATATTTCACAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1216s1c1
Sequence:CCGGGCGTCATCAAGGCAACTTGTTCTCGAGAACAAGTTGCCTTGATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4453s1c1
Sequence:CCGGGCCGTCACTTTCTCATCATTCCTCGAGGAATGATGAGAAAGTGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4316s1c1
Sequence:CCGGGACCAAGTTGTTGCTTAATTTCTCGAGAAATTAAGCAACAACTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1770s1c1
Sequence:CCGGTGATTGTTCACCGGGACATTACTCGAGTAATGTCCCGGTGAACAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1432s1c1
Sequence:CCGGTGCCTTCGGCAGGGTCTATTTCTCGAGAAATAGACCCTGCCGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002401
VALIDATED
MAP3K3 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-320s1c1
Sequence:CCGGACCTCTTGATCTACATTACATCTCGAGATGTAATGTAGATCAAGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-850s1c1
Sequence:CCGGAGGAATACTCAGATCGGGAAACTCGAGTTTCCCGATCTGAGTATTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-2324s1c1
Sequence:CCGGCCAGGGTATGAAGAGTGTTATCTCGAGATAACACTCTTCATACCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002401.x-1313s1c1
Sequence:CCGGGTGCGAGATCCAGTTGCTAAACTCGAGTTTAGCAACTGGATCTCGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002401.x-267s1c1
Sequence:CCGGCGGCCTGTGAAATATGAAGATCTCGAGATCTTCATATTTCACAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1216s1c1
Sequence:CCGGGCGTCATCAAGGCAACTTGTTCTCGAGAACAAGTTGCCTTGATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4453s1c1
Sequence:CCGGGCCGTCACTTTCTCATCATTCCTCGAGGAATGATGAGAAAGTGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002401.3-4316s1c1
Sequence:CCGGGACCAAGTTGTTGCTTAATTTCTCGAGAAATTAAGCAACAACTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1770s1c1
Sequence:CCGGTGATTGTTCACCGGGACATTACTCGAGTAATGTCCCGGTGAACAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002401.3-1432s1c1
Sequence:CCGGTGCCTTCGGCAGGGTCTATTTCTCGAGAAATAGACCCTGCCGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)