EMAIL THIS PAGE TO A FRIEND

MAP3K4

mitogen-activated protein kinase kinase kinase 4

114 Gene Product Result for
Synonyms: MAPKKK4 MEKK4 MTK1 PRO0412
Gene ID:
Human(4216) Summary: The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Two alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(26407) mitogen-activated protein kinase kinase kinase 4
Rat(308106) mitogen activated protein kinase kinase kinase 4
Zebrafish(325488) mitogen activated protein kinase kinase kinase 4
cow(511779) mitogen-activated protein kinase kinase kinase 4
Horse(100058153) mitogen-activated protein kinase kinase kinase 4
domestic cat(101097977) mitogen-activated protein kinase kinase kinase 4
dog(476262) mitogen-activated protein kinase kinase kinase 4
chicken(421579) mitogen-activated protein kinase kinase kinase 4
sheep(101113246) mitogen-activated protein kinase kinase kinase 4
domestic guinea pig(100724828) mitogen-activated protein kinase kinase kinase 4
naked mole-rat(101701961) mitogen-activated protein kinase kinase kinase 4
Domestic Rabbit(100358104) mitogen-activated protein kinase kinase kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007625 Anti-MAP3K4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501864 Anti-MAP3K4 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1306256 ANTI-MEKK4 (CENTER C1081) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0004216M2 Monoclonal Anti-MAP3K4 antibody produced in mouse clone 6C6, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB1404069 Monoclonal Anti-MAP3K4 antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1409314 Monoclonal Anti-MAP3K4 antibody produced in mouse clone 4C3, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1409315 Monoclonal Anti-MAP3K4 antibody produced in mouse clone 6A12, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1409316 Monoclonal Anti-MAP3K4 antibody produced in mouse clone 5D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
M7194 Monoclonal Anti-MEKK4 antibody produced in mouse ~2 mg/mL, clone MEKK4-338, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005922 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005922 siRNAs that have been validated in the lab human pricing
NM_006724 Rosetta Predictions human pricing
NM_001107456 Rosetta Predictions rat pricing
NM_011948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005922 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065380 validated 1132
1 SASI_Hs01_00065382 validated 1809
2 SASI_Hs01_00065381 predicted 4245
3 SASI_Hs01_00065383 predicted 3358
4 SASI_Hs02_00340558 predicted 3442
5 SASI_Hs01_00065384 predicted 1537
6 SASI_Hs02_00340559 predicted 2833
7 SASI_Hs01_00065385 predicted 1627
8 SASI_Hs01_00065386 predicted 901
9 SASI_Hs01_00065388 predicted 913
10 SASI_Hs01_00065389 predicted 1384
11 SASI_Hs01_00065387 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062532 predicted 1126
2 SASI_Hs01_00062533 predicted 4097
3 SASI_Hs01_00062535 predicted 3360
4 SASI_Hs02_00342158 predicted 3439
5 SASI_Hs01_00062536 predicted 1538
6 SASI_Hs02_00342159 predicted 2836
7 SASI_Hs01_00062537 predicted 1629
8 SASI_Hs01_00062538 predicted 908
9 SASI_Hs01_00062540 predicted 918
10 SASI_Hs01_00062541 predicted 1382
11 SASI_Hs01_00062534 predicted 1816
12 SASI_Hs01_00062539 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229005 predicted 683
2 SASI_Rn02_00229006 predicted 3935
3 SASI_Rn02_00229007 predicted 4461
4 SASI_Rn02_00229008 predicted 3698
5 SASI_Rn02_00229009 predicted 3053
6 SASI_Rn02_00229010 predicted 4120
7 SASI_Rn02_00229011 predicted 2849
8 SASI_Rn02_00229012 predicted 3991
9 SASI_Rn02_00229013 predicted 1838
10 SASI_Rn02_00229014 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183121 predicted 2211
2 SASI_Mm01_00183122 predicted 4346
3 SASI_Mm01_00183123 predicted 3936
4 SASI_Mm01_00183124 predicted 4105
5 SASI_Mm01_00183125 predicted 3306
6 SASI_Mm01_00183126 predicted 1250
7 SASI_Mm02_00321812 predicted 4115
8 SASI_Mm01_00183127 predicted 788
9 SASI_Mm02_00321813 predicted 2940
10 SASI_Mm01_00183129 predicted 4253
11 SASI_Mm01_00183128 predicted 3122
12 SASI_Mm01_00183130 predicted 4414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011948
VALIDATED
MAP3K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 4
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-2153s21c1
Sequence:CCGGTCAGGCTTCCCATAGCTTAAACTCGAGTTTAAGCTATGGGAAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-2202s21c1
Sequence:CCGGACCAAAGAAATAACCCATTATCTCGAGATAATGGGTTATTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-4107s21c1
Sequence:CCGGGCCATGAAGGAGATTCGATTTCTCGAGAAATCGAATCTCCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4871s21c1
Sequence:CCGGGATCACTACTGTATGTAATATCTCGAGATATTACATACAGTAGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4309s21c1
Sequence:CCGGAGCACGTCATCAGGTTATATACTCGAGTATATAACCTGATGACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2637s1c1
Sequence:CCGGGCAGTATGTTAAGGTACAGATCTCGAGATCTGTACCTTAACATACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-1792s1c1
Sequence:CCGGCCAGTGGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2079s1c1
Sequence:CCGGGCTCCTGATGAAGCAGTATTACTCGAGTAATACTGCTTCATCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-4341s1c1
Sequence:CCGGCCTTACGTCATCTGGACTAATCTCGAGATTAGTCCAGATGACGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-1964s21c1
Sequence:CCGGAGAGTGTAAAGAGGTCCTAAACTCGAGTTTAGGACCTCTTTACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4846s21c1
Sequence:CCGGTAGTAGTGTGTGGACAGAATCCTCGAGGATTCTGTCCACACACTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-3129s21c1
Sequence:CCGGTTTGGGTTTGAGTATCATAAACTCGAGTTTATGATACTCAAACCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4991s21c1
Sequence:CCGGGTGACAGTGCTGAGGTTAAAGCTCGAGCTTTAACCTCAGCACTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-1064s21c1
Sequence:CCGGTGAGCAGGTGAAGCGGATAATCTCGAGATTATCCGCTTCACCTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011948
VALIDATED
MAP3K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 4
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-2153s21c1
Sequence:CCGGTCAGGCTTCCCATAGCTTAAACTCGAGTTTAAGCTATGGGAAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-2202s21c1
Sequence:CCGGACCAAAGAAATAACCCATTATCTCGAGATAATGGGTTATTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-4107s21c1
Sequence:CCGGGCCATGAAGGAGATTCGATTTCTCGAGAAATCGAATCTCCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4871s21c1
Sequence:CCGGGATCACTACTGTATGTAATATCTCGAGATATTACATACAGTAGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4309s21c1
Sequence:CCGGAGCACGTCATCAGGTTATATACTCGAGTATATAACCTGATGACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2637s1c1
Sequence:CCGGGCAGTATGTTAAGGTACAGATCTCGAGATCTGTACCTTAACATACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-1792s1c1
Sequence:CCGGCCAGTGGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2079s1c1
Sequence:CCGGGCTCCTGATGAAGCAGTATTACTCGAGTAATACTGCTTCATCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-4341s1c1
Sequence:CCGGCCTTACGTCATCTGGACTAATCTCGAGATTAGTCCAGATGACGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-1964s21c1
Sequence:CCGGAGAGTGTAAAGAGGTCCTAAACTCGAGTTTAGGACCTCTTTACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4846s21c1
Sequence:CCGGTAGTAGTGTGTGGACAGAATCCTCGAGGATTCTGTCCACACACTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-3129s21c1
Sequence:CCGGTTTGGGTTTGAGTATCATAAACTCGAGTTTATGATACTCAAACCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4991s21c1
Sequence:CCGGGTGACAGTGCTGAGGTTAAAGCTCGAGCTTTAACCTCAGCACTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-1064s21c1
Sequence:CCGGTGAGCAGGTGAAGCGGATAATCTCGAGATTATCCGCTTCACCTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011948
VALIDATED
MAP3K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 4
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-2153s21c1
Sequence:CCGGTCAGGCTTCCCATAGCTTAAACTCGAGTTTAAGCTATGGGAAGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-2202s21c1
Sequence:CCGGACCAAAGAAATAACCCATTATCTCGAGATAATGGGTTATTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-4107s21c1
Sequence:CCGGGCCATGAAGGAGATTCGATTTCTCGAGAAATCGAATCTCCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4871s21c1
Sequence:CCGGGATCACTACTGTATGTAATATCTCGAGATATTACATACAGTAGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4309s21c1
Sequence:CCGGAGCACGTCATCAGGTTATATACTCGAGTATATAACCTGATGACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2637s1c1
Sequence:CCGGGCAGTATGTTAAGGTACAGATCTCGAGATCTGTACCTTAACATACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-1792s1c1
Sequence:CCGGCCAGTGGAGTTCTCTGACTTTCTCGAGAAAGTCAGAGAACTCCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-2079s1c1
Sequence:CCGGGCTCCTGATGAAGCAGTATTACTCGAGTAATACTGCTTCATCAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011948.1-4341s1c1
Sequence:CCGGCCTTACGTCATCTGGACTAATCTCGAGATTAGTCCAGATGACGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011948.2-1964s21c1
Sequence:CCGGAGAGTGTAAAGAGGTCCTAAACTCGAGTTTAGGACCTCTTTACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011948.2-4846s21c1
Sequence:CCGGTAGTAGTGTGTGGACAGAATCCTCGAGGATTCTGTCCACACACTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-3129s21c1
Sequence:CCGGTTTGGGTTTGAGTATCATAAACTCGAGTTTATGATACTCAAACCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-4991s21c1
Sequence:CCGGGTGACAGTGCTGAGGTTAAAGCTCGAGCTTTAACCTCAGCACTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011948.2-1064s21c1
Sequence:CCGGTGAGCAGGTGAAGCGGATAATCTCGAGATTATCCGCTTCACCTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005922
VALIDATED
MAP3K4 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-5165s1c1
Sequence:CCGGAGGTTAAAGAAGCTGCATGTTCTCGAGAACATGCAGCTTCTTTAACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005922.x-4522s1c1
Sequence:CCGGCCGTGACATTAAAGGTGCCAACTCGAGTTGGCACCTTTAATGTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-1062s1c1
Sequence:CCGGGCTTCGCCTTTGTTAGAGATACTCGAGTATCTCTAACAAAGGCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005922.x-3350s1c1
Sequence:CCGGGCCCGGAAGTGGATGAATTATCTCGAGATAATTCATCCACTTCCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-429s1c1
Sequence:CCGGCAACCAAACATCAGAGGAATACTCGAGTATTCCTCTGATGTTTGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5182s1c1
Sequence:CCGGGCATGTTAAGTGCCATTACTACTCGAGTAGTAATGGCACTTAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-460s21c1
Sequence:CCGGGCCAGCCAGTCGGTCTAATTTCTCGAGAAATTAGACCGACTGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-2069s1c1
Sequence:CCGGCCATCTCTCTTGAGTATTAAGCTCGAGCTTAATACTCAAGAGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-3031s1c1
Sequence:CCGGGCAGTCCATTGAGGGACTTATCTCGAGATAAGTCCCTCAATGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5254s1c1
Sequence:CCGGCCGTGACATCAGCGTAGTGTTCTCGAGAACACTACGCTGATGTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-2288s21c1
Sequence:CCGGCCTCAAGCATCGCATAGTTTACTCGAGTAAACTATGCGATGCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005922
VALIDATED
MAP3K4 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-5165s1c1
Sequence:CCGGAGGTTAAAGAAGCTGCATGTTCTCGAGAACATGCAGCTTCTTTAACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005922.x-4522s1c1
Sequence:CCGGCCGTGACATTAAAGGTGCCAACTCGAGTTGGCACCTTTAATGTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-1062s1c1
Sequence:CCGGGCTTCGCCTTTGTTAGAGATACTCGAGTATCTCTAACAAAGGCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005922.x-3350s1c1
Sequence:CCGGGCCCGGAAGTGGATGAATTATCTCGAGATAATTCATCCACTTCCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-429s1c1
Sequence:CCGGCAACCAAACATCAGAGGAATACTCGAGTATTCCTCTGATGTTTGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5182s1c1
Sequence:CCGGGCATGTTAAGTGCCATTACTACTCGAGTAGTAATGGCACTTAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-460s21c1
Sequence:CCGGGCCAGCCAGTCGGTCTAATTTCTCGAGAAATTAGACCGACTGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-2069s1c1
Sequence:CCGGCCATCTCTCTTGAGTATTAAGCTCGAGCTTAATACTCAAGAGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-3031s1c1
Sequence:CCGGGCAGTCCATTGAGGGACTTATCTCGAGATAAGTCCCTCAATGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5254s1c1
Sequence:CCGGCCGTGACATCAGCGTAGTGTTCTCGAGAACACTACGCTGATGTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-2288s21c1
Sequence:CCGGCCTCAAGCATCGCATAGTTTACTCGAGTAAACTATGCGATGCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005922
VALIDATED
MAP3K4 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-5165s1c1
Sequence:CCGGAGGTTAAAGAAGCTGCATGTTCTCGAGAACATGCAGCTTCTTTAACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005922.x-4522s1c1
Sequence:CCGGCCGTGACATTAAAGGTGCCAACTCGAGTTGGCACCTTTAATGTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-1062s1c1
Sequence:CCGGGCTTCGCCTTTGTTAGAGATACTCGAGTATCTCTAACAAAGGCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005922.x-3350s1c1
Sequence:CCGGGCCCGGAAGTGGATGAATTATCTCGAGATAATTCATCCACTTCCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.x-429s1c1
Sequence:CCGGCAACCAAACATCAGAGGAATACTCGAGTATTCCTCTGATGTTTGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5182s1c1
Sequence:CCGGGCATGTTAAGTGCCATTACTACTCGAGTAGTAATGGCACTTAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-460s21c1
Sequence:CCGGGCCAGCCAGTCGGTCTAATTTCTCGAGAAATTAGACCGACTGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-2069s1c1
Sequence:CCGGCCATCTCTCTTGAGTATTAAGCTCGAGCTTAATACTCAAGAGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-3031s1c1
Sequence:CCGGGCAGTCCATTGAGGGACTTATCTCGAGATAAGTCCCTCAATGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005922.2-5254s1c1
Sequence:CCGGCCGTGACATCAGCGTAGTGTTCTCGAGAACACTACGCTGATGTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005922.2-2288s21c1
Sequence:CCGGCCTCAAGCATCGCATAGTTTACTCGAGTAAACTATGCGATGCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)