EMAIL THIS PAGE TO A FRIEND

MAP3K5

mitogen-activated protein kinase kinase kinase 5

155 Gene Product Result for
Synonyms: ASK1 MAPKKK5 MEKK5
UniProtKB ID: Q99683, Q5THN3, Q99461
Gene ID:
Human(4217) Summary: Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
Mouse(26408) mitogen-activated protein kinase kinase kinase 5
Rat(365057) mitogen-activated protein kinase kinase kinase 5
naked mole-rat(101712051) mitogen-activated protein kinase kinase kinase 5
domestic guinea pig(100722979) mitogen-activated protein kinase kinase kinase 5
sheep(101121018) mitogen-activated protein kinase kinase kinase 5
Zebrafish(555703) mitogen-activated protein kinase kinase kinase 5
chicken(421688) mitogen-activated protein kinase kinase kinase 5
dog(476215) mitogen-activated protein kinase kinase kinase 5
Horse(100073186) mitogen-activated protein kinase kinase kinase 5
cow(537380) mitogen-activated protein kinase kinase kinase 5
domestic cat(101082912) mitogen-activated protein kinase kinase kinase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5851 Anti-ASK-1, C-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
PRS1151 Anti-ASK1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
PRS3677 Anti-ASK1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
PRS3679 Anti-ASK1 (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1306399 ANTI-ASK1 (MEKK5/MAP3K5) (S83) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306050 ANTI-ASK1 (MEKK5/MAP3K5) (S966) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4501865 Anti-ASK1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4501866 Anti-ASK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
M8446 Anti-MAP3K5 (1301-1315) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M8571 Anti-MAP3K5 (406-420) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300398 Anti-MAP3K5 (Ab-83) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300406 Anti-MAP3K5 (Ab-966) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1412213 ANTI-MAP3K5 antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412278 ANTI-MAP3K5 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA063245 Anti-MAP3K5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
HPA064423 Anti-MAP3K5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
SAB4504336 Anti-phospho-ASK1 (pSer83) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504337 Anti-phospho-ASK1 (pSer966) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300145 Anti-phospho-MAP3K5 (pSer83) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300146 Anti-phospho-MAP3K5 (pSer966) antibody produced in rabbit affinity isolated antibody human, monkey, mouse
immunohistochemistry, western blot pricing
WH0004217M1 Monoclonal Anti-MAP3K5 antibody produced in mouse clone 5C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300433 Monoclonal Anti-MAP3K5 antibody produced in mouse clone 2E4, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404070 Monoclonal Anti-MAP3K5, (C-terminal) antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005923 Rosetta Predictions human pricing
XM_001073260 Rosetta Predictions rat pricing
XM_344798 Rosetta Predictions rat pricing
NM_008580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227019 predicted 4369
2 SASI_Hs01_00227021 predicted 4358
3 SASI_Hs01_00227022 predicted 1106
4 SASI_Hs02_00340560 predicted 1879
5 SASI_Hs01_00227023 predicted 3766
6 SASI_Hs01_00227024 predicted 2268
7 SASI_Hs01_00227025 predicted 1333
8 SASI_Hs01_00227026 predicted 1163
9 SASI_Hs01_00227028 predicted 1209
10 SASI_Hs02_00340561 predicted 1818
11 SASI_Hs01_00227020 predicted 3564
12 SASI_Hs01_00227027 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342112 predicted 3432
2 SASI_Rn02_00342113 predicted 2801
3 SASI_Rn02_00342114 predicted 996
4 SASI_Rn02_00342115 predicted 1677
5 SASI_Rn02_00342116 predicted 2631
6 SASI_Rn02_00342117 predicted 2412
7 SASI_Rn02_00342118 predicted 820
8 SASI_Rn02_00342119 predicted 2439
9 SASI_Rn02_00342120 predicted 2033
10 SASI_Rn02_00342121 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397545 predicted 823
2 SASI_Rn02_00397546 predicted 951
3 SASI_Rn02_00397547 predicted 990
4 SASI_Rn02_00397548 predicted 864
5 SASI_Rn02_00397549 predicted 838
6 SASI_Rn02_00397550 predicted 460
7 SASI_Rn02_00397551 predicted 1162
8 SASI_Rn02_00397552 predicted 1304
9 SASI_Rn02_00397553 predicted 564
10 SASI_Rn02_00397554 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123818 predicted 2491
2 SASI_Mm01_00123819 predicted 2449
3 SASI_Mm01_00123820 predicted 1469
4 SASI_Mm01_00123822 predicted 1384
5 SASI_Mm01_00123823 predicted 2711
6 SASI_Mm01_00123824 predicted 2883
7 SASI_Mm02_00314215 predicted 4187
8 SASI_Mm02_00314216 predicted 906
9 SASI_Mm02_00314217 predicted 4032
10 SASI_Mm01_00123825 predicted 2115
11 SASI_Mm01_00123821 predicted 1910
12 SASI_Mm01_00123826 predicted 1224
13 SASI_Mm01_00123827 predicted 3199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005923
VALIDATED
MAP3K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 5
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-4163s21c1
Sequence:CCGGGCACTCCTTCATCGAGCTATTCTCGAGAATAGCTCGATGAAGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3778s21c1
Sequence:CCGGTAAAGTTCTTCGGAATCATAACTCGAGTTATGATTCCGAAGAACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005923.3-4786s21c1
Sequence:CCGGGCTATTGCACTTCAGCCAAATCTCGAGATTTGGCTGAAGTGCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.3-4595s1c1
Sequence:CCGGCCAGTATTTGTTTACTCATGTCTCGAGACATGAGTAAACAAATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-2075s1c1
Sequence:CCGGCCTTCTTATTTGTCTATCAACCTCGAGGTTGATAGACAAATAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-3898s1c1
Sequence:CCGGCCTTGCATCTGAGAGTGATACCTCGAGGTATCACTCTCAGATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-1169s1c1
Sequence:CCGGCAGTACTTCCGGGAATCTATACTCGAGTATAGATTCCCGGAAGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-2716s21c1
Sequence:CCGGGCAAATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3218s21c1
Sequence:CCGGGCTCTTTCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.x-4884s1c1
Sequence:CCGGTGTTTAGGCTTCTGTGTGTTTCTCGAGAAACACACAGAAGCCTAAACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.x-3373s1c1
Sequence:CCGGCTGCGGAGAAAGAGATGTCAACTCGAGTTGACATCTCTTTCTCCGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-1110s1c1
Sequence:CCGGGCTTACCTCTTGTGGATCGTTCTCGAGAACGATCCACAAGAGGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-4331s1c1
Sequence:CCGGGAAGACACTATAAGCCGGTTTCTCGAGAAACCGGCTTATAGTGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-1256s1c1
Sequence:CCGGATTCGGCAGCGAGTAGATAATCTCGAGATTATCTACTCGCTGCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005923
VALIDATED
MAP3K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 5
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-4163s21c1
Sequence:CCGGGCACTCCTTCATCGAGCTATTCTCGAGAATAGCTCGATGAAGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3778s21c1
Sequence:CCGGTAAAGTTCTTCGGAATCATAACTCGAGTTATGATTCCGAAGAACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005923.3-4786s21c1
Sequence:CCGGGCTATTGCACTTCAGCCAAATCTCGAGATTTGGCTGAAGTGCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.3-4595s1c1
Sequence:CCGGCCAGTATTTGTTTACTCATGTCTCGAGACATGAGTAAACAAATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-2075s1c1
Sequence:CCGGCCTTCTTATTTGTCTATCAACCTCGAGGTTGATAGACAAATAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-3898s1c1
Sequence:CCGGCCTTGCATCTGAGAGTGATACCTCGAGGTATCACTCTCAGATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-1169s1c1
Sequence:CCGGCAGTACTTCCGGGAATCTATACTCGAGTATAGATTCCCGGAAGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-2716s21c1
Sequence:CCGGGCAAATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3218s21c1
Sequence:CCGGGCTCTTTCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.x-4884s1c1
Sequence:CCGGTGTTTAGGCTTCTGTGTGTTTCTCGAGAAACACACAGAAGCCTAAACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.x-3373s1c1
Sequence:CCGGCTGCGGAGAAAGAGATGTCAACTCGAGTTGACATCTCTTTCTCCGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-1110s1c1
Sequence:CCGGGCTTACCTCTTGTGGATCGTTCTCGAGAACGATCCACAAGAGGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-4331s1c1
Sequence:CCGGGAAGACACTATAAGCCGGTTTCTCGAGAAACCGGCTTATAGTGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-1256s1c1
Sequence:CCGGATTCGGCAGCGAGTAGATAATCTCGAGATTATCTACTCGCTGCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005923
VALIDATED
MAP3K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 5
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-4163s21c1
Sequence:CCGGGCACTCCTTCATCGAGCTATTCTCGAGAATAGCTCGATGAAGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3778s21c1
Sequence:CCGGTAAAGTTCTTCGGAATCATAACTCGAGTTATGATTCCGAAGAACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005923.3-4786s21c1
Sequence:CCGGGCTATTGCACTTCAGCCAAATCTCGAGATTTGGCTGAAGTGCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.3-4595s1c1
Sequence:CCGGCCAGTATTTGTTTACTCATGTCTCGAGACATGAGTAAACAAATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-2075s1c1
Sequence:CCGGCCTTCTTATTTGTCTATCAACCTCGAGGTTGATAGACAAATAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-3898s1c1
Sequence:CCGGCCTTGCATCTGAGAGTGATACCTCGAGGTATCACTCTCAGATGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.3-1169s1c1
Sequence:CCGGCAGTACTTCCGGGAATCTATACTCGAGTATAGATTCCCGGAAGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-2716s21c1
Sequence:CCGGGCAAATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005923.3-3218s21c1
Sequence:CCGGGCTCTTTCAGCTGGATCAAATCTCGAGATTTGATCCAGCTGAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005923.x-4884s1c1
Sequence:CCGGTGTTTAGGCTTCTGTGTGTTTCTCGAGAAACACACAGAAGCCTAAACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.x-3373s1c1
Sequence:CCGGCTGCGGAGAAAGAGATGTCAACTCGAGTTGACATCTCTTTCTCCGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-1110s1c1
Sequence:CCGGGCTTACCTCTTGTGGATCGTTCTCGAGAACGATCCACAAGAGGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005923.x-4331s1c1
Sequence:CCGGGAAGACACTATAAGCCGGTTTCTCGAGAAACCGGCTTATAGTGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005923.3-1256s1c1
Sequence:CCGGATTCGGCAGCGAGTAGATAATCTCGAGATTATCTACTCGCTGCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008580
VALIDATED
MAP3K5 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2495s21c1
Sequence:CCGGGATAGTCCACCGGGATATAAACTCGAGTTTATATCCCGGTGGACTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2456s21c1
Sequence:CCGGGCAGATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2557s1c1
Sequence:CCGGCGGGATATAAAGGGTGACAATCTCGAGATTGTCACCCTTTATATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2259s1c1
Sequence:CCGGCCAGGTCAGAATTGCTATTAACTCGAGTTAATAGCAATTCTGACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2933s1c1
Sequence:CCGGCCTGTGCTAATGACTTGCTTACTCGAGTAAGCAAGTCATTAGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008580.1-4018s1c1
Sequence:CCGGCCCATAGATATCCCTGGGTTTCTCGAGAAACCCAGGGATATCTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-1203s1c1
Sequence:CCGGCGTGAAGTTTCATTACGCATTCTCGAGAATGCGTAATGAAACTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008580.4-2640s21c1
Sequence:CCGGGCGCCAGAAATAATCGATAAACTCGAGTTTATCGATTATTTCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008580
VALIDATED
MAP3K5 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2495s21c1
Sequence:CCGGGATAGTCCACCGGGATATAAACTCGAGTTTATATCCCGGTGGACTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2456s21c1
Sequence:CCGGGCAGATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2557s1c1
Sequence:CCGGCGGGATATAAAGGGTGACAATCTCGAGATTGTCACCCTTTATATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2259s1c1
Sequence:CCGGCCAGGTCAGAATTGCTATTAACTCGAGTTAATAGCAATTCTGACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2933s1c1
Sequence:CCGGCCTGTGCTAATGACTTGCTTACTCGAGTAAGCAAGTCATTAGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008580.1-4018s1c1
Sequence:CCGGCCCATAGATATCCCTGGGTTTCTCGAGAAACCCAGGGATATCTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-1203s1c1
Sequence:CCGGCGTGAAGTTTCATTACGCATTCTCGAGAATGCGTAATGAAACTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008580.4-2640s21c1
Sequence:CCGGGCGCCAGAAATAATCGATAAACTCGAGTTTATCGATTATTTCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008580
VALIDATED
MAP3K5 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2495s21c1
Sequence:CCGGGATAGTCCACCGGGATATAAACTCGAGTTTATATCCCGGTGGACTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008580.4-2456s21c1
Sequence:CCGGGCAGATACTGGAAGGATTAAACTCGAGTTTAATCCTTCCAGTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2557s1c1
Sequence:CCGGCGGGATATAAAGGGTGACAATCTCGAGATTGTCACCCTTTATATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2259s1c1
Sequence:CCGGCCAGGTCAGAATTGCTATTAACTCGAGTTAATAGCAATTCTGACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-2933s1c1
Sequence:CCGGCCTGTGCTAATGACTTGCTTACTCGAGTAAGCAAGTCATTAGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008580.1-4018s1c1
Sequence:CCGGCCCATAGATATCCCTGGGTTTCTCGAGAAACCCAGGGATATCTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008580.1-1203s1c1
Sequence:CCGGCGTGAAGTTTCATTACGCATTCTCGAGAATGCGTAATGAAACTTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008580.4-2640s21c1
Sequence:CCGGGCGCCAGAAATAATCGATAAACTCGAGTTTATCGATTATTTCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)