EMAIL THIS PAGE TO A FRIEND

MAP3K6

mitogen-activated protein kinase kinase kinase 6

84 Gene Product Result for
Synonyms: ASK2 MAPKKK6 MEKK6
Gene ID:
Human(9064) Summary: This gene encodes a member of the serine/threonine protein kinase family. The encoded kinase was identified by its interaction with MAP3K5/ASK, a protein kinase and an activator of c-Jun kinase (MAPK7/JNK) and MAPK14/p38 kinase. This kinase was found to weakly activate MAPK7, but not MAPK1/ERK or MAPK14. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(53608) mitogen-activated protein kinase kinase kinase 6
Rat(313022) mitogen-activated protein kinase kinase kinase 6
chicken(100858193) mitogen-activated protein kinase kinase kinase 6
cow(614598) mitogen-activated protein kinase kinase kinase 6
Horse(100070933) mitogen-activated protein kinase kinase kinase 6
domestic cat(101081315) mitogen-activated protein kinase kinase kinase 6
dog(487345) mitogen-activated protein kinase kinase kinase 6
sheep(101113737) mitogen-activated protein kinase kinase kinase 6
domestic guinea pig(100724385) mitogen-activated protein kinase kinase kinase 6
naked mole-rat(101697616) mitogen-activated protein kinase kinase kinase 6
Domestic Rabbit(100343069) mitogen-activated protein kinase kinase kinase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004672 Rosetta Predictions human pricing
NM_001107909 Rosetta Predictions rat pricing
NM_016693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338102 predicted 1178
2 SASI_Hs01_00042922 predicted 2151
3 SASI_Hs01_00042923 predicted 2817
4 SASI_Hs01_00042924 predicted 3953
5 SASI_Hs01_00042925 predicted 3758
6 SASI_Hs01_00042926 predicted 3995
7 SASI_Hs01_00042927 predicted 3821
8 SASI_Hs01_00042928 predicted 1321
9 SASI_Hs01_00042929 predicted 2562
10 SASI_Hs01_00042930 predicted 3478
11 SASI_Hs01_00042931 predicted 3934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233475 predicted 2881
2 SASI_Rn02_00233476 predicted 2539
3 SASI_Rn02_00233477 predicted 796
4 SASI_Rn02_00233478 predicted 3358
5 SASI_Rn02_00233479 predicted 825
6 SASI_Rn02_00233480 predicted 3870
7 SASI_Rn02_00233481 predicted 1487
8 SASI_Rn02_00233482 predicted 1471
9 SASI_Rn02_00233483 predicted 791
10 SASI_Rn02_00233484 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043721 predicted 961
2 SASI_Mm01_00043722 predicted 1084
3 SASI_Mm01_00043723 predicted 775
4 SASI_Mm01_00043724 predicted 3652
5 SASI_Mm01_00043725 predicted 3975
6 SASI_Mm01_00043726 predicted 4022
7 SASI_Mm01_00043727 predicted 3663
8 SASI_Mm01_00043728 predicted 821
9 SASI_Mm01_00043729 predicted 1337
10 SASI_Mm01_00043730 predicted 3980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004672
VALIDATED
MAP3K6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 6
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1283s1c1
Sequence:CCGGCAACCATTCAAGACAGCCTGTCTCGAGACAGGCTGTCTTGAATGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-832s1c1
Sequence:CCGGCATGTTCTTCAGCTCGGGTTTCTCGAGAAACCCGAGCTGAAGAACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1039s1c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2163s21c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1660s1c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-3795s1c1
Sequence:CCGGAGCGTATTAAACAGAACACTTCTCGAGAAGTGTTCTGTTTAATACGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2887s21c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-1542s21c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-2887s1c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-662s1c1
Sequence:CCGGGCTTCAGCATGACCAACAATGCTCGAGCATTGTTGGTCATGCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4117s1c1
Sequence:CCGGGAGCTGAATGAGGGCATCATACTCGAGTATGATGCCCTCATTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4159s1c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004672.3-3541s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004672.3-4159s21c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004672
VALIDATED
MAP3K6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 6
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1283s1c1
Sequence:CCGGCAACCATTCAAGACAGCCTGTCTCGAGACAGGCTGTCTTGAATGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-832s1c1
Sequence:CCGGCATGTTCTTCAGCTCGGGTTTCTCGAGAAACCCGAGCTGAAGAACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1039s1c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2163s21c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1660s1c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-3795s1c1
Sequence:CCGGAGCGTATTAAACAGAACACTTCTCGAGAAGTGTTCTGTTTAATACGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2887s21c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-1542s21c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-2887s1c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-662s1c1
Sequence:CCGGGCTTCAGCATGACCAACAATGCTCGAGCATTGTTGGTCATGCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4117s1c1
Sequence:CCGGGAGCTGAATGAGGGCATCATACTCGAGTATGATGCCCTCATTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4159s1c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004672.3-3541s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004672.3-4159s21c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004672
VALIDATED
MAP3K6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 6
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1283s1c1
Sequence:CCGGCAACCATTCAAGACAGCCTGTCTCGAGACAGGCTGTCTTGAATGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-832s1c1
Sequence:CCGGCATGTTCTTCAGCTCGGGTTTCTCGAGAAACCCGAGCTGAAGAACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1039s1c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2163s21c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-1660s1c1
Sequence:CCGGGTTGGAGTTTGATTATGAGTACTCGAGTACTCATAATCAAACTCCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.x-3795s1c1
Sequence:CCGGAGCGTATTAAACAGAACACTTCTCGAGAAGTGTTCTGTTTAATACGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-2887s21c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004672.3-1542s21c1
Sequence:CCGGCGTGGAGAAGATGCAGTATTACTCGAGTAATACTGCATCTTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-2887s1c1
Sequence:CCGGCAAGCCTTTCTCCTCCGAACTCTCGAGAGTTCGGAGGAGAAAGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-662s1c1
Sequence:CCGGGCTTCAGCATGACCAACAATGCTCGAGCATTGTTGGTCATGCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4117s1c1
Sequence:CCGGGAGCTGAATGAGGGCATCATACTCGAGTATGATGCCCTCATTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004672.3-4159s1c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004672.3-3541s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004672.3-4159s21c1
Sequence:CCGGGATGAATGGAGAGGACAAAGGCTCGAGCCTTTGTCCTCTCCATTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016693
VALIDATED
MAP3K6 MISSION shRNA Bacterial Glycerol Stock
mitogen-activated protein kinase kinase kinase 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016693.5-3941s21c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2782s1c1
Sequence:CCGGGCACTGTAATCGAGATGGCAACTCGAGTTGCCATCTCGATTACAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-2507s21c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-4149s21c1
Sequence:CCGGGACATCAAAGGACACAGATACCTCGAGGTATCTGTGTCCTTTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-3939s1c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016693.2-1711s1c1
Sequence:CCGGCCTTCCTACTGTACCAGCATTCTCGAGAATGCTGGTACAGTAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2505s1c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-956s1c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-958s21c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016693
VALIDATED
MAP3K6 MISSION shRNA shRNA Plasmid DNA
mitogen-activated protein kinase kinase kinase 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016693.5-3941s21c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2782s1c1
Sequence:CCGGGCACTGTAATCGAGATGGCAACTCGAGTTGCCATCTCGATTACAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-2507s21c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-4149s21c1
Sequence:CCGGGACATCAAAGGACACAGATACCTCGAGGTATCTGTGTCCTTTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-3939s1c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016693.2-1711s1c1
Sequence:CCGGCCTTCCTACTGTACCAGCATTCTCGAGAATGCTGGTACAGTAGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2505s1c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-956s1c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-958s21c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016693
VALIDATED
MAP3K6 MISSION shRNA Lentiviral Transduction Particles
mitogen-activated protein kinase kinase kinase 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016693.5-3941s21c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2782s1c1
Sequence:CCGGGCACTGTAATCGAGATGGCAACTCGAGTTGCCATCTCGATTACAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-2507s21c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-4149s21c1
Sequence:CCGGGACATCAAAGGACACAGATACCTCGAGGTATCTGTGTCCTTTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-3939s1c1
Sequence:CCGGCTACAGGAACTGAGTGTAGATCTCGAGATCTACACTCAGTTCCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016693.2-1711s1c1
Sequence:CCGGCCTTCCTACTGTACCAGCATTCTCGAGAATGCTGGTACAGTAGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-2505s1c1
Sequence:CCGGGAGAGCACTATTAGCTTCTATCTCGAGATAGAAGCTAATAGTGCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016693.2-956s1c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016693.5-958s21c1
Sequence:CCGGCACAGACTCTTGCGGCTATTTCTCGAGAAATAGCCGCAAGAGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)